Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 10

1.

rs13387042 [Homo sapiens]
    CCAGAACAGAAAGAAGGCAAATGGA[A/G]GCTACAGAAACCAAGGATTTCCTTG
    Chromosome:
    2:217041109
    Gene:
    LOC101928278 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4742/2375
    HGVS:
    NC_000002.11:g.217905832A>G, NC_000002.12:g.217041109A>G, XR_923881.1:n.299+47091A>G, XR_923883.1:n.294+47091A>G, XR_923885.1:n.862+47091A>G, XR_923886.1:n.359-14082A>G, XR_923887.1:n.300-14082A>G
    2.

    rs13281615 [Homo sapiens]
      GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
      Chromosome:
      8:127343372
      Gene:
      CASC21 (GeneView) CASC8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4912/2460
      HGVS:
      NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
      3.

      rs10808556 [Homo sapiens]
        AAACCTGATTTCCCTTCCAGCTCCA[C/T]CTCTGACCAATTGCCTGACCCTGGT
        Chromosome:
        8:127400902
        Gene:
        CASC8 (GeneView) CCAT2 (GeneView)
        Functional Consequence:
        intron variant,nc transcript variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4724/2366
        HGVS:
        NC_000008.10:g.128413147C>T, NC_000008.11:g.127400902C>T, NR_109834.1:n.504C>T, NR_117100.1:n.1176+19927G>A
        4.

        rs10505477 [Homo sapiens]
          TTGTCTATCAAACAGGAAGCCTTAA[C/T]TGGAGATGAAGATTTAGAAAAGGGG
          Chromosome:
          8:127395198
          Gene:
          CASC8 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4231/2119
          HGVS:
          NC_000008.10:g.128407443A>G, NC_000008.11:g.127395198A>G, NR_117100.1:n.1176+25631T>C
          5.

          rs6983267 [Homo sapiens]
            GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
            Chromosome:
            8:127401060
            Gene:
            CASC8 (GeneView) CCAT2 (GeneView)
            Functional Consequence:
            intron variant,nc transcript variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3902/1954
            HGVS:
            NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
            6.
            7.

            rs3803662 [Homo sapiens]
              TCTCCTTAATGCCTCTATAGCTGTC[C/T]CTTAGCGAAGAATAAAACTGTGGAC
              Chromosome:
              16:52552429
              Gene:
              CASC16 (GeneView)
              Functional Consequence:
              nc transcript variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.4403/2205
              HGVS:
              NC_000016.10:g.52552429A>G, NC_000016.9:g.52586341A>G, NG_012623.1:g.374T>C, NR_033920.1:n.659T>C, XR_243421.1:n.92T>C
              10.

              rs889312 [Homo sapiens]
                CTGAGATGCCCCTGCTGGAGAAAGG[A/C]ATGTGCAAATTAAGAGACTACAAAT
                Chromosome:
                5:56736057
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                C=0.3870/1938
                HGVS:
                NC_000005.10:g.56736057C>A, NC_000005.9:g.56031884C>A

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Write to the Help Desk