Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 72

1.

rs17740111 [Homo sapiens]
    AGTTTTGTTAGTGTTTTCATTCATC[C/G]TAAGTTCTGTTCTTTAAACTCTTTT
    Chromosome:
    16:84373822
    Gene:
    ATP2C2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1707/855
    HGVS:
    NC_000016.10:g.84373822G>C, NC_000016.9:g.84407428G>C, NM_001286527.2:c.99+5108G>C, NM_014861.3:c.99+5108G>C, XM_005256270.1:c.99+5108G>C
    2.

    rs17568951 [Homo sapiens]
      TCTTGTGAATAGAAGGTCTTCTTTA[C/T]AGTTGAGCACATGAGTGTGGTCAGT
      Chromosome:
      2:47580354
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1250/626
      HGVS:
      NC_000002.11:g.47807493T>C, NC_000002.12:g.47580354T>C
      3.

      rs13276133 [Homo sapiens]
        AGTGGTTTCAATGACCATTTCTTCT[A/C]CTTGCCTTTTTAAAACAGCCTAACT
        Chromosome:
        8:72943025
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.1813/908
        HGVS:
        NC_000008.10:g.73855260A>C, NC_000008.11:g.72943025A>C
        4.

        rs13267466 [Homo sapiens]
          GCATGGAGGCAGGTGCTGAAAAATC[A/C]GAGGTGAATTTGACAAATTTGTTCC
          Chromosome:
          8:132327150
          Gene:
          KCNQ3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1260/631
          HGVS:
          NC_000008.10:g.133339397A>C, NC_000008.11:g.132327150A>C, NG_008854.2:g.158608T>G, NM_001204824.1:c.26+120051T>G, NM_004519.3:c.387-140969T>G, XM_005250912.1:c.309-140969T>G, XM_011517026.1:c.26+103313T>G
          5.

          rs12996816 [Homo sapiens]
            AAACCATGCTTTATGGACATCTTGG[C/T]TGTGTGGGTTGAAGTGTCCTTCAGG
            Chromosome:
            2:17863421
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.0699/350
            HGVS:
            NC_000002.11:g.18044688C>T, NC_000002.12:g.17863421C>T
            6.

            rs12622743 [Homo sapiens]
              TATAAACACTCTAGAATCATACTTG[A/G]ACCAATAAGAACTCAATACATACCT
              Chromosome:
              2:166337881
              Gene:
              SCN9A (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1701/852
              HGVS:
              NC_000002.11:g.167194391A>G, NC_000002.12:g.166337881A>G, NG_012798.1:g.43107T>C, NM_002977.3:c.-50-26075T>C, XM_005246757.1:c.-50-26075T>C, XM_011511616.1:c.-50-26075T>C, XM_011511617.1:c.-50-26075T>C, XM_011511618.1:c.-50-26075T>C, XM_011511619.1:c.-50-26075T>C
              7.

              rs12567520 [Homo sapiens]
                AGTATCTTGAGGTGTTTATATTTGC[A/G/T]TGTCAATCAGTCAAGAATATTTATT
                Chromosome:
                1:215155924
                Gene:
                KCNK2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2216/1110
                HGVS:
                NC_000001.10:g.215329267G>A, NC_000001.11:g.215155924G>A, NM_001017424.2:c.464-13275G>A, NM_001017425.2:c.476-13275G>A, NM_014217.3:c.431-13275G>A, XM_011509521.1:c.434-13275G>A, XM_011509522.1:c.308-13275G>A, XM_011509523.1:c.308-13275G>A, XM_011509524.1:c.308-13275G>A, XR_247027.1:n.844-13275G>A
                8.

                rs12550268 [Homo sapiens]
                  CACGAGTTTTAGATCACTGCAACCA[A/G]TTGGCCATATACCTCCAATTAAGAC
                  Chromosome:
                  8:72523859
                  Gene:
                  LOC105375897 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.3155/1580
                  HGVS:
                  NC_000008.10:g.73436094A>G, NC_000008.11:g.72523859A>G, XR_929042.1:n.768-6401T>C
                  9.

                  rs12143625 [Homo sapiens]
                    ATCCAGTAGCTCATGCCAGAATCCT[C/T]TCAGTCATTCCTGATGCTGTCTTCT
                    Chromosome:
                    1:215218497
                    Gene:
                    KCNK2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3714/1860
                    HGVS:
                    NC_000001.10:g.215391840C>T, NC_000001.11:g.215218497C>T, NM_001017424.2:c.952-16331C>T, NM_001017425.2:c.964-16331C>T, NM_014217.3:c.919-16331C>T, XM_011509521.1:c.922-16331C>T, XM_011509522.1:c.796-16331C>T, XM_011509523.1:c.796-16331C>T, XM_011509524.1:c.796-16331C>T, XR_247027.1:n.1145-16331C>T
                    10.

                    rs12073221 [Homo sapiens]
                      TGTGGTTCCTCTGTCTTCTCTCTCT[C/G]TAAATTTTTTGACTTCTGATCTTTC
                      Chromosome:
                      1:181444938
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.2907/1456
                      HGVS:
                      NC_000001.10:g.181414074G>C, NC_000001.11:g.181444938G>C
                      11.

                      rs11898284 [Homo sapiens]
                        TTTTGTTAATTGTGACAAATGCGCC[A/G]TACTAATATAAACTGTTAATAACAG
                        Chromosome:
                        2:166325017
                        Gene:
                        SCN9A (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.1595/799
                        HGVS:
                        NC_000002.11:g.167181527A>G, NC_000002.12:g.166325017A>G, NG_012798.1:g.55971T>C, NM_002977.3:c.-50-13211T>C, XM_005246757.1:c.-50-13211T>C, XM_011511616.1:c.-50-13211T>C, XM_011511617.1:c.-50-13211T>C, XM_011511618.1:c.-50-13211T>C, XM_011511619.1:c.-50-13211T>C
                        12.

                        rs11890824 [Homo sapiens]
                          TAAGGGATATTTCATATACACATTC[A/T]AAAGTAGGATGATTCTGAAAGGTAA
                          Chromosome:
                          2:166314399
                          Gene:
                          SCN9A (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.4255/2131
                          HGVS:
                          NC_000002.11:g.167170909A>T, NC_000002.12:g.166314399A>T, NG_012798.1:g.66589T>A, NM_002977.3:c.-50-2593T>A, XM_005246757.1:c.-50-2593T>A, XM_011511616.1:c.-50-2593T>A, XM_011511617.1:c.-50-2593T>A, XM_011511618.1:c.-50-2593T>A, XM_011511619.1:c.-50-2593T>A
                          13.

                          rs11882861 [Homo sapiens]
                            CCAGTGAAGAAGGGTCTTAGAATAG[A/G]AGAGCCCAGACTTAGCTGAGAGGAG
                            Chromosome:
                            19:13451411
                            Gene:
                            CACNA1A (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.2861/1433
                            HGVS:
                            NC_000019.10:g.13451411A>G, NC_000019.9:g.13562225A>G, NG_011569.1:g.60050T>C, NM_000068.3:c.539+1465T>C, NM_001127221.1:c.539+1465T>C, NM_001127222.1:c.539+1465T>C, NM_001174080.1:c.539+1465T>C, NM_023035.2:c.539+1465T>C, XM_005260065.1:c.539+1465T>C, XM_005260066.1:c.539+1465T>C, XM_005260067.1:c.539+1465T>C, XM_005260068.1:c.539+1465T>C
                            14.

                            rs11782118 [Homo sapiens]
                              GTAGGCAAGACATTTACCATGCTGT[A/G]AGTGAAGTCAAAAAGGACAGTAGTC
                              Chromosome:
                              8:72937968
                              Gene:
                              KCNB2 (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2362/1183
                              HGVS:
                              NC_000008.10:g.73850203G>A, NC_000008.11:g.72937968G>A, NM_004770.2:c.2613G>A, NP_004761.2:p.Val871
                              17.

                              rs11596974 [Homo sapiens]
                                ACGACAGAGTGACCAAACATGAAAG[A/G]GTGAAATGTAAGTAACTGCCCATCC
                                Chromosome:
                                10:18131455
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.2672/1338
                                HGVS:
                                NC_000010.10:g.18420384G>A, NC_000010.11:g.18131455G>A
                                18.

                                rs11120499 [Homo sapiens]
                                  CATGTAAATGTCCTCTCTCTGCTAG[G/T]TTGTCATTCAGTGCCCAAAAGCTAT
                                  Chromosome:
                                  1:215125465
                                  Gene:
                                  KCNK2 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  G=0.4778/2393
                                  HGVS:
                                  NC_000001.10:g.215298808T>G, NC_000001.11:g.215125465T>G, NM_001017424.2:c.463+715T>G, NM_001017425.2:c.475+715T>G, NM_014217.3:c.430+715T>G, XM_011509521.1:c.433+715T>G, XM_011509522.1:c.307+715T>G, XM_011509523.1:c.307+715T>G, XM_011509524.1:c.307+715T>G, XR_247027.1:n.843+715T>G
                                  20.

                                  rs10494994 [Homo sapiens]
                                    AAAAGGAGGGTTTGTGTGACTGCTA[A/G]GGAGATGTTTTATATTCATTGGTCA
                                    Chromosome:
                                    1:215188864
                                    Gene:
                                    KCNK2 (GeneView) LOC105372917 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.2296/1150
                                    HGVS:
                                    NC_000001.10:g.215362207G>A, NC_000001.11:g.215188864G>A, NM_001017424.2:c.812-6089G>A, NM_001017425.2:c.824-6089G>A, NM_014217.3:c.779-6089G>A, XM_011509521.1:c.782-6089G>A, XM_011509522.1:c.656-6089G>A, XM_011509523.1:c.656-6089G>A, XM_011509524.1:c.656-6089G>A, XR_247027.1:n.1005-6089G>A, XR_922594.1:n.182+1737C>T

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Write to the Help Desk