Display Settings:

Format

Send to:

Choose Destination
1.

rs6265 [Homo sapiens]
    ATCATTGGCTGACACTTTCGAACAC[A/G]TGATAGAAGAGCTGTTGGATGAGGA
    Chromosome:
    11:27658369
    Gene:
    BDNF-AS (GeneView) BDNF (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.2013/1008
    HGVS:
    NC_000011.10:g.27658369C>T, NC_000011.9:g.27679916C>T, NG_011794.1:g.68690G>A, NM_001143805.1:c.196G>A, NM_001143806.1:c.196G>A, NM_001143807.1:c.196G>A, NM_001143808.1:c.196G>A, NM_001143809.1:c.283G>A, NM_001143810.1:c.442G>A, NM_001143811.1:c.196G>A, NM_001143812.1:c.196G>A, NM_001143813.1:c.196G>A, NM_001143814.1:c.196G>A, NM_001143816.1:c.196G>A, NM_001709.4:c.196G>A, NM_170731.4:c.220G>A, NM_170732.4:c.196G>A, NM_170733.3:c.196G>A, NM_170734.3:c.241G>A, NM_170735.5:c.196G>A, NP_001137277.1:p.Val66Met, NP_001137278.1:p.Val66Met, NP_001137279.1:p.Val66Met, NP_001137280.1:p.Val66Met, NP_001137281.1:p.Val95Met, NP_001137282.1:p.Val148Met, NP_001137283.1:p.Val66Met, NP_001137284.1:p.Val66Met, NP_001137285.1:p.Val66Met, NP_001137286.1:p.Val66Met, NP_001137288.1:p.Val66Met, NP_001700.2:p.Val66Met, NP_733927.1:p.Val74Met, NP_733928.1:p.Val66Met, NP_733929.1:p.Val66Met, NP_733930.1:p.Val81Met, NP_733931.1:p.Val66Met, NR_002832.2:n.503C>T, NR_033312.1:n.434C>T, NR_033313.1:n.434C>T, NR_033314.1:n.503C>T, NR_033315.1:n.434C>T, XM_005253060.1:c.442G>A, XM_011520280.1:c.442G>A, XP_005253117.1:p.Val148Met, XP_011518582.1:p.Val148Met, XR_242807.1:n.355C>T, XR_242808.1:n.352C>T, XR_242809.1:n.224-802C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk