Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 2

1.

rs3775291 [Homo sapiens]
    GAGATTTTATTCTTGGTTAGGTTGA[A/C/G]TATGTGTAAGGGAGAATGAGCAAGT
    Chromosome:
    4:186082920
    Gene:
    TLR3 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2318/1161
    HGVS:
    NC_000004.11:g.187004074C>T, NC_000004.12:g.186082920C>T, NG_007278.1:g.18766C>T, NM_003265.2:c.1234C>T, NP_003256.1:p.Leu412Phe
    2.

    rs179008 [Homo sapiens]
      TTTCCAATGTGGACACTGAAGAGAC[A/C/T]AATTCTTATCCTTTTTAACATAATC
      Chromosome:
      X:12885540
      Gene:
      TLR7 (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1181/446
      HGVS:
      NC_000023.10:g.12903659A>T, NC_000023.11:g.12885540A>T, NG_012569.1:g.23458A>T, NM_016562.3:c.32A>T, NP_057646.1:p.Gln11Leu

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk