Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 50

7.
9.

rs11568700 [Homo sapiens]
    TTGGAGAGGAGTTGCAAGGGTAAGT[C/T]GGAGGCAGTAAAGTGGGCATTAAGG
    Chromosome:
    13:95247636
    Gene:
    ABCC4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0138/69
    HGVS:
    NC_000013.10:g.95899890G>A, NC_000013.11:g.95247636G>A, NM_001105515.2:c.185+7C>T, NM_001301829.1:c.185+7C>T, NM_001301830.1:c.185+7C>T, NM_005845.4:c.185+7C>T, XM_005254025.1:c.56+7C>T, XM_005254025.2:c.56+7C>T, XM_005254026.1:c.185+7C>T, XM_005254027.1:c.185+7C>T, XM_005254028.1:c.185+7C>T, XM_006719914.1:c.185+7C>T
    13.
    20.

    rs11568682 [Homo sapiens]
      CACGCGTGTTCTTCTGGTGAGTGTC[C/T]CCGCCCGAAACAGGTCACCCTGCAG
      Chromosome:
      13:95301231
      Gene:
      ABCC4 (GeneView) LOC102724149 (GeneView)
      Functional Consequence:
      intron variant,nc transcript variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0066/33
      HGVS:
      NC_000013.10:g.95953485G>A, NC_000013.11:g.95301231G>A, NM_001105515.2:c.74+10C>T, NM_001301829.1:c.74+10C>T, NM_001301830.1:c.74+10C>T, NM_005845.4:c.74+10C>T, XM_005254026.1:c.74+10C>T, XM_005254027.1:c.74+10C>T, XM_005254028.1:c.74+10C>T, XM_006719914.1:c.74+10C>T, XR_429273.2:n.596G>A, XR_931650.1:n.600G>A

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk