Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 9

5.

rs386834074 [Homo sapiens]
    TAACTTCATGAATACTACAAACTTC[-/C]AGTCTCTTCGGCCTTTGCCATCCAT
    Chromosome:
    8:99156582
    Gene:
    VPS13B (GeneView)
    Functional Consequence:
    frameshift variant,nc transcript variant
    Allele Origin:
    C(unknown)/(germline,unknown)
    Clinical significance:
    Likely pathogenic
    Validated:
    no info
    HGVS:
    NC_000008.10:g.100168810delC, NC_000008.11:g.99156582delC, NG_007098.2:g.148317delC, NM_015243.2:c.2047delC, NM_017890.4:c.2047delC, NM_152564.4:c.2047delC, NP_056058.2:p.Gln683Serfs, NP_060360.3:p.Gln683Serfs, NP_689777.3:p.Gln683Serfs, XM_005250800.1:c.2047delC, XM_005250800.2:c.2047delC, XM_005250801.1:c.2047delC, XM_005250801.3:c.2047delC, XM_005250802.1:c.2047delC, XM_005250803.1:c.2047delC, XM_006716510.2:c.2047delC, XM_006716511.2:c.2047delC, XM_011516848.1:c.2047delC, XM_011516849.1:c.2047delC, XM_011516850.1:c.1669delC, XM_011516853.1:c.2047delC, XM_011516855.1:c.2047delC, XM_011516856.1:c.2047delC, XM_011516857.1:c.2047delC, XM_011516858.1:c.2047delC, XM_011516859.1:c.2047delC, XM_011516860.1:c.2047delC, XM_011516861.1:c.2047delC, XM_011516862.1:c.2047delC, XM_011516863.1:c.2047delC, XM_011516864.1:c.2047delC, XM_011516865.1:c.2047delC, XM_011516866.1:c.2047delC, XP_005250857.1:p.Gln683Serfs, XP_005250858.1:p.Gln683Serfs, XP_005250859.1:p.Gln683Serfs, XP_005250860.1:p.Gln683Serfs, XP_006716573.1:p.Gln683Serfs, XP_006716574.1:p.Gln683Serfs, XP_011515150.1:p.Gln683Serfs, XP_011515151.1:p.Gln683Serfs, XP_011515152.1:p.Gln557Serfs, XP_011515155.1:p.Gln683Serfs, XP_011515157.1:p.Gln683Serfs, XP_011515158.1:p.Gln683Serfs, XP_011515159.1:p.Gln683Serfs, XP_011515160.1:p.Gln683Serfs, XP_011515161.1:p.Gln683Serfs, XP_011515162.1:p.Gln683Serfs, XP_011515163.1:p.Gln683Serfs, XP_011515164.1:p.Gln683Serfs, XP_011515165.1:p.Gln683Serfs, XP_011515166.1:p.Gln683Serfs, XP_011515167.1:p.Gln683Serfs, XP_011515168.1:p.Gln683Serfs, XR_928301.1:n.2150delC, XR_928302.1:n.2150delC, XR_928303.1:n.2150delC, XR_928304.1:n.2150delC

    Display Settings:

    Format
    Items per page
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk