Display Settings:

Format

Send to:

Choose Destination
1.

rs6567274 [Homo sapiens]
    ACACAGAGACTGTTTTGCCTCGTGG[G/T]AATGATGGTTCCTGGCTTTAATCTG
    Chromosome:
    18:62370567
    Gene:
    TNFRSF11A (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1971/987
    HGVS:
    NC_000018.10:g.62370567G>T, NC_000018.9:g.60037800G>T, NG_008098.1:g.50253G>T, NM_001270949.1:c.783+3807G>T, NM_001270950.1:c.730+8774G>T, NM_001270951.1:c.616+10518G>T, NM_001278268.1:c.1525+1083G>T, NM_003839.2:c.1567+1083G>T, NM_003839.3:c.1567+1083G>T, XM_005266777.1:c.1567+1083G>T, XM_011526244.1:c.1582+1083G>T, XM_011526245.1:c.1459+1083G>T, XR_935263.1:n.1597+1083G>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk