Display Settings:

Format
Sort by

Send to:

Choose Destination

Results: 2

1.

rs2740483 [Homo sapiens]
    GAACTACATAAACAGAGGCCGGGAA[C/G]GGGGCGGGGAGGAGGGAGAGCACAG
    Chromosome:
    9:104928254
    Gene:
    ABCA1 (GeneView) LOC105376196 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2129/1066
    HGVS:
    NC_000009.11:g.107690535G>C, NC_000009.12:g.104928254G>C, NG_007981.1:g.4902C>G, NM_005502.3:c.-412C>G, XM_005251773.1:c.-412C>G, XM_005251776.1:c.-434C>G, XM_005251777.1:c.-412C>G, XM_005251778.1:c.-412C>G, XM_005251780.1:c.-412C>G, XM_011518339.1:c.-412C>G, XM_011518341.1:c.-412C>G, XM_011518342.1:c.-475C>G, XM_011518343.1:c.-412C>G, XM_011518344.1:c.-412C>G, XR_930204.1:n.734+344G>C

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk