Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 211

1.

rs36213074 [Homo sapiens]
    ATCGTCATGTGTCTTTAAAAATGCA[C/T]ATTACTAAATCTATTTTTTTTTCAG
    Chromosome:
    10:122456881
    Gene:
    ARMS2 (GeneView) LOC105378525 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.0747/374
    HGVS:
    NC_000010.10:g.124216397T>C, NC_000010.11:g.122456881T>C, NG_011554.1:g.357T>C, NG_011725.1:g.7219T>C, NM_001099667.1:c.298-26T>C, XR_946382.1:n.1827+1614A>G, XR_946383.1:n.1827+1614A>G, XR_946384.1:n.1576+1614A>G, XR_946385.1:n.1827+1614A>G
    2.

    rs36212733 [Homo sapiens]
      TTTGTGCTTGCCATAGTATATATAA[C/T]TAGACAAATGAGAGAACACAAAGGT
      Chromosome:
      10:122455695
      Gene:
      ARMS2 (GeneView) LOC105378525 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.2865/1435
      HGVS:
      NC_000010.10:g.124215211T>C, NC_000010.11:g.122455695T>C, NG_011725.1:g.6033T>C, NM_001099667.1:c.297+671T>C, XR_946382.1:n.1827+2800A>G, XR_946383.1:n.1827+2800A>G, XR_946384.1:n.1576+2800A>G, XR_946385.1:n.1828-674A>G
      3.

      rs36212732 [Homo sapiens]
        GGAACTGTGGCGCTTTGTGCTTGCC[A/G]TAGTATATATAATTAGACAAATGAG
        Chromosome:
        10:122455682
        Gene:
        ARMS2 (GeneView) LOC105378525 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.2865/1435
        HGVS:
        NC_000010.10:g.124215198A>G, NC_000010.11:g.122455682A>G, NG_011725.1:g.6020A>G, NM_001099667.1:c.297+658A>G, XR_946382.1:n.1827+2813T>C, XR_946383.1:n.1827+2813T>C, XR_946384.1:n.1576+2813T>C, XR_946385.1:n.1828-661T>C
        4.

        rs36212731 [Homo sapiens]
          TGTACCATTCTTTCAATATTCTCAC[G/T]GCTTTCCAGTGCTCATTTTTCCTGC
          Chromosome:
          10:122455460
          Gene:
          ARMS2 (GeneView) LOC105378525 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.2869/1437
          HGVS:
          NC_000010.10:g.124214976G>T, NC_000010.11:g.122455460G>T, NG_011725.1:g.5798G>T, NM_001099667.1:c.297+436G>T, XR_946382.1:n.1827+3035C>A, XR_946383.1:n.1827+3035C>A, XR_946384.1:n.1576+3035C>A, XR_946385.1:n.1828-439C>A
          5.

          rs36212730 [Homo sapiens]
            TTAGAAAGCTGTACCATTCTTTCAA[C/T]ATTCTCACGGCTTTCCAGTGCTCAT
            Chromosome:
            10:122455451
            Gene:
            ARMS2 (GeneView) LOC105378525 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by cluster
            HGVS:
            NC_000010.10:g.124214967T>C, NC_000010.11:g.122455451T>C, NG_011725.1:g.5789T>C, NM_001099667.1:c.297+427T>C, XR_946382.1:n.1827+3044A>G, XR_946383.1:n.1827+3044A>G, XR_946384.1:n.1576+3044A>G, XR_946385.1:n.1828-430A>G
            6.

            rs36212729 [Homo sapiens]
              ATTCTTTCTAAAAATATGGAACTGA[A/T]AGAAAAGAAACTTATAGACTACATT
              Chromosome:
              10:122897855
              Gene:
              LOC399815 (GeneView)
              Functional Consequence:
              nc transcript variant
              Validated:
              no info
              HGVS:
              NC_000010.10:g.124657371T>A, NC_000010.11:g.122897855T>A, NR_027282.1:n.1253T>A
              7.

              rs36212728 [Homo sapiens]
                CGAAAAACCGCCGTGGTGCCCGCGC[A/G]CAGTGCACCGCGCCTGCGCATGGTC
                Chromosome:
                10:122879577
                Gene:
                FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
                Functional Consequence:
                nc transcript variant,upstream variant 2KB,utr variant 5 prime
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                G=0.0302/151
                HGVS:
                NC_000010.10:g.124639093A>G, NC_000010.11:g.122879577A>G, NM_001204364.1:c.-240T>C, NM_152644.2:c.-270T>C, NR_027282.1:n.-56A>G, NR_037911.1:n.65T>C, NR_037915.1:n.65T>C
                8.

                rs36212727 [Homo sapiens]
                  TACCTGACCATAGACGCTCCCCATC[C/T]GCCCAGCAACCGTGGTCCATGCTGC
                  Chromosome:
                  10:122879507
                  Gene:
                  FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
                  Functional Consequence:
                  nc transcript variant,upstream variant 2KB,utr variant 5 prime
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.0088/44
                  HGVS:
                  NC_000010.10:g.124639023C>T, NC_000010.11:g.122879507C>T, NM_001204364.1:c.-170G>A, NM_152644.2:c.-200G>A, NR_027282.1:n.-126C>T, NR_037911.1:n.135G>A, NR_037915.1:n.135G>A
                  9.

                  rs36212726 [Homo sapiens]
                    AGGCAGGGAGAGTTCGGAGTAAAAT[C/T]AACCCGAATGGACAGCGCTTCCGCC
                    Chromosome:
                    10:122879331
                    Gene:
                    FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    C=0.0156/78
                    HGVS:
                    NC_000010.10:g.124638847T>C, NC_000010.11:g.122879331T>C, NM_001204364.1:c.-148+154A>G, NM_152644.2:c.-178+154A>G, NR_027282.1:n.-302T>C, NR_037911.1:n.157+154A>G, NR_037915.1:n.157+154A>G
                    10.

                    rs36212725 [Homo sapiens]
                      CAGGACATGTAGCTTTTTGGCCATG[C/T]TGAAGAATCTCTGTGGAAAGAATTC
                      Chromosome:
                      10:122863143
                      Gene:
                      FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      C=0.0192/96
                      HGVS:
                      NC_000010.10:g.124622659T>C, NC_000010.11:g.122863143T>C, NM_001204364.1:c.-147-7357A>G, NM_152644.2:c.-177-7357A>G, NR_037911.1:n.158-7357A>G, NR_037915.1:n.158-7357A>G
                      11.

                      rs36212724 [Homo sapiens]
                        GGTATTTAGCTAAATGACTGTGTAA[A/G]AATCACCTGTGGAAGGTATATTCCC
                        Chromosome:
                        10:122862874
                        Gene:
                        FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        A=0.0192/96
                        HGVS:
                        NC_000010.10:g.124622390G>A, NC_000010.11:g.122862874G>A, NM_001204364.1:c.-147-7088C>T, NM_152644.2:c.-177-7088C>T, NR_037911.1:n.158-7088C>T, NR_037915.1:n.158-7088C>T
                        12.

                        rs36212413 [Homo sapiens]
                          TTCTCTCCAGGTGTCCAAATGGGAG[A/G]AACCAATTGCTGATGGTATTTAGCT
                          Chromosome:
                          10:122862834
                          Gene:
                          FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          G=0.0164/82
                          HGVS:
                          NC_000010.10:g.124622350A>G, NC_000010.11:g.122862834A>G, NM_001204364.1:c.-147-7048T>C, NM_152644.2:c.-177-7048T>C, NR_037911.1:n.158-7048T>C, NR_037915.1:n.158-7048T>C
                          13.

                          rs36212412 [Homo sapiens]
                            ACAAATGCAAATAATAATTCTTCTA[A/G]TATAACAATGTTCCTTCTGCCTTAT
                            Chromosome:
                            10:122862734
                            Gene:
                            FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            G=0.0192/96
                            HGVS:
                            NC_000010.10:g.124622250A>G, NC_000010.11:g.122862734A>G, NM_001204364.1:c.-147-6948T>C, NM_152644.2:c.-177-6948T>C, NR_037911.1:n.158-6948T>C, NR_037915.1:n.158-6948T>C
                            14.

                            rs36212411 [Homo sapiens]
                              TTGCAGACTTCAGGTTTCCATCAGC[A/G]GTTCCTCTTCCAGGACTCAGGAAAC
                              Chromosome:
                              10:122858991
                              Gene:
                              FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency
                              Global MAF:
                              A=0.0200/100
                              HGVS:
                              NC_000010.10:g.124618507G>A, NC_000010.11:g.122858991G>A, NM_001204364.1:c.-147-3205C>T, NM_152644.2:c.-177-3205C>T, NR_037911.1:n.158-3205C>T, NR_037915.1:n.158-3205C>T
                              15.

                              rs36212410 [Homo sapiens]
                                TTTGTTTTGTTGGGTGGGGGCACAC[A/T]TTCATGAGTCATATCTCCAGGAACT
                                Chromosome:
                                10:122852435
                                Gene:
                                FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                T=0.0200/100
                                HGVS:
                                NC_000010.10:g.124611951A>T, NC_000010.11:g.122852435A>T, NM_001204364.1:c.-5-1915T>A, NM_152644.2:c.-35-1885T>A, NR_037911.1:n.300-2996T>A, NR_037915.1:n.299+3210T>A
                                16.

                                rs36212409 [Homo sapiens]
                                  GAGTGAGTGATTTTGCAAGCAAGGT[C/T]ACCCAACTGGTCACTGCAGGCCCCC
                                  Chromosome:
                                  10:122849679
                                  Gene:
                                  FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000010.10:g.124609195C>T, NC_000010.11:g.122849679C>T, NM_001204364.1:c.93-240G>A, NM_152644.2:c.93-240G>A, NR_037911.1:n.300-240G>A, NR_037915.1:n.300-3459G>A
                                  17.

                                  rs36212408 [Homo sapiens]
                                    TAAATGTAAACTGAGGTTACAAAAG[C/T]AAGAGTGAGTGATTTTGCAAGCAAG
                                    Chromosome:
                                    10:122849651
                                    Gene:
                                    FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000010.10:g.124609167C>T, NC_000010.11:g.122849651C>T, NM_001204364.1:c.93-212G>A, NM_152644.2:c.93-212G>A, NR_037911.1:n.300-212G>A, NR_037915.1:n.300-3431G>A
                                    18.

                                    rs36212407 [Homo sapiens]
                                      TGGGGAGCTGTGCCTTTCTTCTGTG[C/T]CTGCACATCACAAACAGGTGGCCTC
                                      Chromosome:
                                      10:122846150
                                      Gene:
                                      CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                                      Functional Consequence:
                                      nc transcript variant,utr variant 5 prime
                                      Validated:
                                      by 1000G,by cluster,by frequency
                                      Global MAF:
                                      T=0.0499/250
                                      HGVS:
                                      NC_000010.10:g.124605666C>T, NC_000010.11:g.122846150C>T, NM_022034.5:c.-307G>A, NR_037912.1:n.26G>A, NR_037915.1:n.370G>A
                                      19.

                                      rs36212406 [Homo sapiens]
                                        TGCTGACCTTGAAGGACCTCTGTGA[A/G]CCAGTGCCGGGCACACAGCCATCAT
                                        Chromosome:
                                        10:122840986
                                        Gene:
                                        CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by cluster,by frequency
                                        Global MAF:
                                        A=0.0006/3
                                        HGVS:
                                        NC_000010.10:g.124600502G>A, NC_000010.11:g.122840986G>A, NM_022034.5:c.233+192C>T, NR_037912.1:n.415-1755C>T, NR_037915.1:n.909+192C>T
                                        20.

                                        rs36212405 [Homo sapiens]
                                          TGTGCATTGAGCTTAACACATCTCT[C/T]CTGAGTATGATTCCATCTCTATCTT
                                          Chromosome:
                                          10:122837645
                                          Gene:
                                          CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000010.10:g.124597161C>T, NC_000010.11:g.122837645C>T, NM_022034.5:c.449-91G>A, NR_037912.1:n.630-91G>A, NR_037915.1:n.1125-91G>A

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk