Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 11

1.
2.

rs111033303 [Homo sapiens]
    TTGATATTTGGTGGCTTGCAGATTG[G/T]ATTCATAGTGAGGTACTTGGCAGAT
    Chromosome:
    7:107674970
    Gene:
    SLC26A4 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000007.13:g.107315415G>T, NC_000007.14:g.107674970G>T, NG_008489.1:g.19336G>T, NM_000441.1:c.626G>T, NP_000432.1:p.Gly209Val, XM_005250425.1:c.626G>T, XM_006716025.2:c.626G>T, XP_005250482.1:p.Gly209Val, XP_006716088.1:p.Gly209Val
    4.

    rs111033220 [Homo sapiens]
      GTGGCCACCACTGCTCTTTCCCGCA[C/T]GGCCGTCCAGGAGAGCACTGGAGGA
      Chromosome:
      7:107690203
      Gene:
      SLC26A4 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by 1000G,by cluster
      Global MAF:
      T=0.0002/1
      HGVS:
      NC_000007.13:g.107330648C>T, NC_000007.14:g.107690203C>T, NG_008489.1:g.34569C>T, NM_000441.1:c.1229C>T, NP_000432.1:p.Thr410Met, XM_005250425.1:c.1229C>T, XM_005250426.1:c.-1851C>T, XM_005250428.1:c.-1851C>T, XM_006716025.2:c.1229C>T, XP_005250482.1:p.Thr410Met, XP_006716088.1:p.Thr410Met
      5.

      rs111033212 [Homo sapiens]
        ATTTTTCACTTAAAAACTCACTAGG[A/C/T]TTTTGCCTCCTGAACTTCCACCTGT
        Chromosome:
        7:107689054
        Gene:
        SLC26A4 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.0008/4
        HGVS:
        NC_000007.13:g.107329499T>C, NC_000007.14:g.107689054T>C, NG_008489.1:g.33420T>C, NM_000441.1:c.1003T>C, NP_000432.1:p.Phe335Leu, XM_005250425.1:c.1003T>C, XM_006716025.2:c.1003T>C, XP_005250482.1:p.Phe335Leu, XP_006716088.1:p.Phe335Leu
        7.

        rs111033199 [Homo sapiens]
          CTTTGGAACATCAAGACATATCTCA[G/T]TTGGTAATTATAAGTATATTTTACA
          Chromosome:
          7:107672245
          Gene:
          SLC26A4 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/T(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster,by frequency
          HGVS:
          NC_000007.13:g.107312690G>T, NC_000007.14:g.107672245G>T, NG_008489.1:g.16611G>T, NM_000441.1:c.412G>T, NP_000432.1:p.Val138Phe, XM_005250425.1:c.412G>T, XM_006716025.2:c.412G>T, XP_005250482.1:p.Val138Phe, XP_006716088.1:p.Val138Phe
          8.

          rs80338849 [Homo sapiens]
            GCATTGTTAAATCCATCCCAAGGGG[A/G/T]TGAGTGTGGTGTTCCTCTTAGTACT
            Chromosome:
            7:107683538
            Gene:
            SLC26A4 (GeneView)
            Functional Consequence:
            splice donor variant
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster
            HGVS:
            NC_000007.13:g.107323983G>A, NC_000007.14:g.107683538G>A, NG_008489.1:g.27904G>A, NM_000441.1:c.1001+1G>A, XM_005250425.1:c.1001+1G>A, XM_006716025.2:c.1001+1G>A
            9.

            rs80338848 [Homo sapiens]
              GCCTTCCAAGTGCTGGTCTCACAGC[C/T]AAAGATTGTCCTCAATGTTTCAACC
              Chromosome:
              7:107675051
              Gene:
              SLC26A4 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Pathogenic
              Validated:
              by cluster,by frequency
              HGVS:
              NC_000007.13:g.107315496T>C, NC_000007.14:g.107675051T>C, NG_008489.1:g.19417T>C, NM_000441.1:c.707T>C, NP_000432.1:p.Leu236Pro, XM_005250425.1:c.707T>C, XM_006716025.2:c.707T>C, XP_005250482.1:p.Leu236Pro, XP_006716088.1:p.Leu236Pro
              10.

              rs55638457 [Homo sapiens]
                CAGAAACTAATAAAAAGTGGACAAT[C/T]AAGAGCAACAAAGGTGAGATGACAT
                Chromosome:
                7:107701183
                Gene:
                SLC26A4 (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                Benign
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                C=0.0086/43
                HGVS:
                NC_000007.13:g.107341628T>C, NC_000007.14:g.107701183T>C, NG_008489.1:g.45549T>C, NM_000441.1:c.1790T>C, NP_000432.1:p.Leu597Ser, XM_005250425.1:c.1790T>C, XM_005250426.1:c.551T>C, XM_005250427.1:c.497T>C, XM_005250428.1:c.473T>C, XP_005250482.1:p.Leu597Ser, XP_005250483.1:p.Leu184Ser, XP_005250484.1:p.Leu166Ser, XP_005250485.1:p.Leu158Ser
                11.

                rs28939086 [Homo sapiens]
                  TTCCCGCACGGCCGTCCAGGAGAGC[A/C]CTGGAGGAAAGACACAGGTAGGAAC
                  Chromosome:
                  7:107690220
                  Gene:
                  SLC26A4 (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  A(germline)/C(germline)
                  Clinical significance:
                  Pathogenic
                  Validated:
                  by cluster
                  HGVS:
                  NC_000007.13:g.107330665A>C, NC_000007.14:g.107690220A>C, NG_008489.1:g.34586A>C, NM_000441.1:c.1246A>C, NP_000432.1:p.Thr416Pro, XM_005250425.1:c.1246A>C, XM_005250426.1:c.-1834A>C, XM_005250428.1:c.-1834A>C, XM_006716025.2:c.1246A>C, XP_005250482.1:p.Thr416Pro, XP_006716088.1:p.Thr416Pro

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Write to the Help Desk