Display Settings:

Format

Send to:

Choose Destination
1.

rs28939702 [Homo sapiens]
    TGCCCACGTGGGGCTGCACACACTG[A/C/T]GCTCCAGGATCAGCATCATCCCCCA
    Chromosome:
    16:16154899
    Gene:
    ABCC6 (GeneView) LOC105371101 (GeneView)
    Functional Consequence:
    downstream variant 500B,intron variant,missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000016.10:g.16154899G>A, NC_000016.10:g.16154899G>T, NC_000016.9:g.16248756G>A, NC_000016.9:g.16248756G>T, NG_007558.2:g.73573C>A, NG_007558.2:g.73573C>T, NM_001171.5:c.4015C>A, NM_001171.5:c.4015C>T, NP_001162.4:p.Arg1339Cys, NP_001162.4:p.Arg1339Ser, NT_187607.1:g.1812827G>A, NT_187607.1:g.1812827G>T, XM_011522479.1:c.3982C>A, XM_011522479.1:c.3982C>T, XM_011522480.1:c.3673C>A, XM_011522480.1:c.3673C>T, XM_011522481.1:c.3673C>A, XM_011522481.1:c.3673C>T, XM_011546696.1:c.3673C>A, XM_011546696.1:c.3673C>T, XM_011546697.1:c.3673C>A, XM_011546697.1:c.3673C>T, XP_011520781.1:p.Arg1328Cys, XP_011520781.1:p.Arg1328Ser, XP_011520782.1:p.Arg1225Cys, XP_011520782.1:p.Arg1225Ser, XP_011520783.1:p.Arg1225Cys, XP_011520783.1:p.Arg1225Ser, XP_011544998.1:p.Arg1225Cys, XP_011544998.1:p.Arg1225Ser, XP_011544999.1:p.Arg1225Cys, XP_011544999.1:p.Arg1225Ser, XR_243279.1:n.4432C>A, XR_243279.1:n.4432C>T, XR_932836.1:n.4313C>A, XR_932836.1:n.4313C>T, XR_932837.1:n.4051C>A, XR_932837.1:n.4051C>T, XR_932838.1:n.4114C>A, XR_932838.1:n.4114C>T, XR_933134.1:n.539-4882G>A, XR_933134.1:n.539-4882G>T, XR_951901.1:n.4311C>A, XR_951901.1:n.4311C>T, XR_951902.1:n.4048C>A, XR_951902.1:n.4048C>T, XR_951903.1:n.4112C>A, XR_951903.1:n.4112C>T, XR_951923.1:n.539-4882G>A, XR_951923.1:n.539-4882G>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk