Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 1638

1.

rs781707187 [Homo sapiens]
    CTGAGGTATTTGGTGCCCTTGCTGC[A/T]GCAGCAGGTCAAGGACACAAGCCTG
    Chromosome:
    4:3116172
    Gene:
    HTT (GeneView)
    Functional Consequence:
    missense
    Validated:
    no info
    HGVS:
    NC_000004.11:g.3117899A>T, NC_000004.12:g.3116172A>T, NG_009378.1:g.46498A>T, NM_002111.6:c.983A>T, NM_002111.7:c.983A>T, NP_002102.4:p.Gln328Leu, XM_005247964.1:c.977A>T, XM_005247965.1:c.263A>T, XP_005248021.1:p.Gln326Leu, XP_005248022.1:p.Gln88Leu
    2.

    rs781689831 [Homo sapiens]
      AGCAAGTCACAAGGCCGAGCACAGC[A/G]CCTTGGCTCCTCCAGTGTGAGGCCA
      Chromosome:
      4:3172996
      Gene:
      HTT (GeneView)
      Functional Consequence:
      missense
      Validated:
      no info
      HGVS:
      NC_000004.11:g.3174723G>A, NC_000004.12:g.3172996G>A, NG_009378.1:g.103322G>A, NM_002111.6:c.4037G>A, NM_002111.7:c.4037G>A, NP_002102.4:p.Arg1346His, XM_005247964.1:c.3983G>A, XM_005247965.1:c.3317G>A, XP_005248021.1:p.Arg1328His, XP_005248022.1:p.Arg1106His
      3.

      rs781609227 [Homo sapiens]
        GGGAGGGGATTTTGGCACAGCATTC[C/G/T]CTGAGATCCCCGTGGAGTTCCTCCA
        Chromosome:
        4:3220236
        Gene:
        HTT (GeneView)
        Functional Consequence:
        missense
        Validated:
        by cluster
        HGVS:
        NC_000004.11:g.3221963C>T, NC_000004.12:g.3220236C>T, NG_009378.1:g.150562C>T, NM_002111.6:c.7303C>T, NM_002111.7:c.7303C>T, NP_002102.4:p.Pro2435Ser, XM_005247964.1:c.7249C>T, XM_005247965.1:c.6583C>T, XP_005248021.1:p.Pro2417Ser, XP_005248022.1:p.Pro2195Ser
        4.

        rs781546405 [Homo sapiens]
          ACAGAGTTTGTGACCCACGCCTGCT[C/T]CCTCATCTACTGTGTGCACTTCATC
          Chromosome:
          4:3214100
          Gene:
          HTT (GeneView)
          Functional Consequence:
          missense
          Validated:
          no info
          HGVS:
          NC_000004.11:g.3215827C>T, NC_000004.12:g.3214100C>T, NG_009378.1:g.144426C>T, NM_002111.6:c.6923C>T, NM_002111.7:c.6923C>T, NP_002102.4:p.Ser2308Phe, XM_005247964.1:c.6869C>T, XM_005247965.1:c.6203C>T, XP_005248021.1:p.Ser2290Phe, XP_005248022.1:p.Ser2068Phe
          5.

          rs781546220 [Homo sapiens]
            ACCTCACTGGTGCTCAGTGCAATGA[C/T]TGTGCCTGTGGCCGGCAACCCAGCT
            Chromosome:
            4:3223479
            Gene:
            HTT (GeneView)
            Functional Consequence:
            missense
            Validated:
            no info
            HGVS:
            NC_000004.11:g.3225206C>T, NC_000004.12:g.3223479C>T, NG_009378.1:g.153805C>T, NM_002111.6:c.7550C>T, NM_002111.7:c.7550C>T, NP_002102.4:p.Thr2517Ile, XM_005247964.1:c.7496C>T, XM_005247965.1:c.6830C>T, XP_005248021.1:p.Thr2499Ile, XP_005248022.1:p.Thr2277Ile
            6.

            rs781538201 [Homo sapiens]
              GACCCGAAGAATCAGTCCAGGAGAC[C/G]TTGGCTGCAGCTGTTCCCAAAATTA
              Chromosome:
              4:3107357
              Gene:
              HTT (GeneView)
              Functional Consequence:
              synonymous codon
              Validated:
              no info
              HGVS:
              NC_000004.11:g.3109084C>G, NC_000004.12:g.3107357C>G, NG_009378.1:g.37683C>G, NM_002111.6:c.687C>G, NM_002111.7:c.687C>G, NP_002102.4:p.Thr229, XM_005247964.1:c.681C>G, XP_005248021.1:p.Thr227
              7.

              rs781477850 [Homo sapiens]
                ATCTGCTCCATCCTCAGCAGGTCCC[A/G]CTTCCACGTGGGAGATTGGATGGGC
                Chromosome:
                4:3132676
                Gene:
                HTT (GeneView)
                Functional Consequence:
                missense
                Validated:
                by frequency
                HGVS:
                NC_000004.11:g.3134403G>A, NC_000004.12:g.3132676G>A, NG_009378.1:g.63002G>A, NM_002111.6:c.2357G>A, NM_002111.7:c.2357G>A, NP_002102.4:p.Arg786His, XM_005247964.1:c.2303G>A, XM_005247965.1:c.1637G>A, XP_005248021.1:p.Arg768His, XP_005248022.1:p.Arg546His
                8.

                rs781405304 [Homo sapiens]
                  CAGCTCCAGCCAGGTCAGCGCCGTC[C/T]CATCTGACCCTGCCATGGACCTGAA
                  Chromosome:
                  4:3127482
                  Gene:
                  HTT (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  no info
                  HGVS:
                  NC_000004.11:g.3129209C>T, NC_000004.12:g.3127482C>T, NG_009378.1:g.57808C>T, NM_002111.6:c.1627C>T, NM_002111.7:c.1627C>T, NP_002102.4:p.Pro543Ser, XM_005247964.1:c.1573C>T, XM_005247965.1:c.907C>T, XP_005248021.1:p.Pro525Ser, XP_005248022.1:p.Pro303Ser
                  9.

                  rs781398411 [Homo sapiens]
                    TATTTTTGTTATTAGAATATATAGA[A/G]GCTATAACCTACTACCAAGCATAAC
                    Chromosome:
                    4:3142776
                    Gene:
                    HTT (GeneView)
                    Functional Consequence:
                    missense
                    Validated:
                    no info
                    HGVS:
                    NC_000004.11:g.3144503G>A, NC_000004.12:g.3142776G>A, NG_009378.1:g.73102G>A, NM_002111.6:c.2962G>A, NM_002111.7:c.2962G>A, NP_002102.4:p.Gly988Ser, XM_005247964.1:c.2908G>A, XM_005247965.1:c.2242G>A, XP_005248021.1:p.Gly970Ser, XP_005248022.1:p.Gly748Ser
                    10.

                    rs781353727 [Homo sapiens]
                      CAGCGCCGTCCCATCTGACCCTGCC[A/G]TGGACCTGAATGATGGGACCCAGGC
                      Chromosome:
                      4:3127497
                      Gene:
                      HTT (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      by frequency
                      HGVS:
                      NC_000004.11:g.3129224A>G, NC_000004.12:g.3127497A>G, NG_009378.1:g.57823A>G, NM_002111.6:c.1642A>G, NM_002111.7:c.1642A>G, NP_002102.4:p.Met548Val, XM_005247964.1:c.1588A>G, XM_005247965.1:c.922A>G, XP_005248021.1:p.Met530Val, XP_005248022.1:p.Met308Val
                      11.

                      rs781308516 [Homo sapiens]
                        CAGCCTCCATCTCATTTCTCCGTCA[A/G]CACAATAACCAGGTATGCTGACCCA
                        Chromosome:
                        4:3140644
                        Gene:
                        HTT (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        no info
                        HGVS:
                        NC_000004.11:g.3142371G>A, NC_000004.12:g.3140644G>A, NG_009378.1:g.70970G>A, NM_002111.6:c.2939G>A, NM_002111.7:c.2939G>A, NP_002102.4:p.Ser980Asn, XM_005247964.1:c.2885G>A, XM_005247965.1:c.2219G>A, XP_005248021.1:p.Ser962Asn, XP_005248022.1:p.Ser740Asn
                        12.

                        rs781300228 [Homo sapiens]
                          CGTCCCTCCTCCCAGGATCAGGAAA[A/G]GCTTTCCTTGTGAAGCCAGAGTGGT
                          Chromosome:
                          4:3238457
                          Gene:
                          HTT (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by frequency
                          HGVS:
                          NC_000004.11:g.3240184G>A, NC_000004.12:g.3238457G>A, NG_009378.1:g.168783G>A, NM_002111.6:c.8908G>A, NM_002111.7:c.8908G>A, NP_002102.4:p.Gly2970Ser, XM_005247964.1:c.8854G>A, XM_005247965.1:c.8188G>A, XP_005248021.1:p.Gly2952Ser, XP_005248022.1:p.Gly2730Ser
                          13.

                          rs781299127 [Homo sapiens]
                            TTGAAAAACATGAGTCACTGCAGGC[A/G]GCCTTCTGACAGCAGTGTTGATAAA
                            Chromosome:
                            4:3130350
                            Gene:
                            HTT (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            by frequency
                            HGVS:
                            NC_000004.11:g.3132077A>G, NC_000004.12:g.3130350A>G, NG_009378.1:g.60676A>G, NM_002111.6:c.1919A>G, NM_002111.7:c.1919A>G, NP_002102.4:p.Gln640Arg, XM_005247964.1:c.1865A>G, XM_005247965.1:c.1199A>G, XP_005248021.1:p.Gln622Arg, XP_005248022.1:p.Gln400Arg
                            14.

                            rs781263790 [Homo sapiens]
                              CGCATATTCCACAGGAAACACCGGG[C/G]TGGAGTTGACATCCACTCCTGTTCG
                              Chromosome:
                              4:3228891
                              Gene:
                              HTT (GeneView)
                              Functional Consequence:
                              missense
                              Validated:
                              no info
                              HGVS:
                              NC_000004.11:g.3230618C>G, NC_000004.12:g.3228891C>G, NG_009378.1:g.159217C>G, NM_002111.6:c.7997C>G, NM_002111.7:c.7997C>G, NP_002102.4:p.Ala2666Gly, XM_005247964.1:c.7943C>G, XM_005247965.1:c.7277C>G, XP_005248021.1:p.Ala2648Gly, XP_005248022.1:p.Ala2426Gly
                              15.

                              rs781260492 [Homo sapiens]
                                CGCATGGTCGACATCCTTGCTTGTC[A/G]CCGGGTAGAAATGCTTCTGGCTGCA
                                Chromosome:
                                4:3206949
                                Gene:
                                HTT (GeneView)
                                Functional Consequence:
                                missense
                                Validated:
                                by frequency
                                HGVS:
                                NC_000004.11:g.3208676G>A, NC_000004.12:g.3206949G>A, NG_009378.1:g.137275G>A, NM_002111.6:c.6047G>A, NM_002111.7:c.6047G>A, NP_002102.4:p.Arg2016His, XM_005247964.1:c.5993G>A, XM_005247965.1:c.5327G>A, XP_005248021.1:p.Arg1998His, XP_005248022.1:p.Arg1776His
                                16.

                                rs781232530 [Homo sapiens]
                                  AGCAACATACTTTCTATTGCCAGGA[A/G]CTAGGCACACTGCTAATGTGTCTGA
                                  Chromosome:
                                  4:3189050
                                  Gene:
                                  HTT (GeneView)
                                  Functional Consequence:
                                  synonymous codon
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000004.11:g.3190777A>G, NC_000004.12:g.3189050A>G, NG_009378.1:g.119376A>G, NM_002111.6:c.5331A>G, NM_002111.7:c.5331A>G, NP_002102.4:p.Glu1777, XM_005247964.1:c.5277A>G, XM_005247965.1:c.4611A>G, XP_005248021.1:p.Glu1759, XP_005248022.1:p.Glu1537
                                  17.

                                  rs781216636 [Homo sapiens]
                                    TCTTTTTTTCTTTTTTATAGAATGC[G/T]ATTCATAATCACATTCGTTTGTTTG
                                    Chromosome:
                                    4:3174951
                                    Gene:
                                    HTT (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000004.11:g.3176678T>G, NC_000004.12:g.3174951T>G, NG_009378.1:g.105277T>G, NM_002111.6:c.4257T>G, NM_002111.7:c.4257T>G, NP_002102.4:p.Ala1419, XM_005247964.1:c.4203T>G, XM_005247965.1:c.3537T>G, XP_005248021.1:p.Ala1401, XP_005248022.1:p.Ala1179
                                    18.

                                    rs781211490 [Homo sapiens]
                                      GAGATTTTGGCCCCTTCCTCCCTCC[G/T]TCCGGTAGACATGCTTTTACGGAGT
                                      Chromosome:
                                      4:3186670
                                      Gene:
                                      HTT (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      by frequency
                                      HGVS:
                                      NC_000004.11:g.3188397G>T, NC_000004.12:g.3186670G>T, NG_009378.1:g.116996G>T, NM_002111.6:c.4946G>T, NM_002111.7:c.4946G>T, NP_002102.4:p.Arg1649Leu, XM_005247964.1:c.4892G>T, XM_005247965.1:c.4226G>T, XP_005248021.1:p.Arg1631Leu, XP_005248022.1:p.Arg1409Leu
                                      19.

                                      rs781175874 [Homo sapiens]
                                        AGCGCCTCCTGCTCTCTGAGCAGCT[A/C]TCCCGCCTGGATGCAGAATCGCTGG
                                        Chromosome:
                                        4:3235666
                                        Gene:
                                        HTT (GeneView)
                                        Functional Consequence:
                                        synonymous codon
                                        Validated:
                                        by frequency
                                        HGVS:
                                        NC_000004.11:g.3237393C>A, NC_000004.12:g.3235666C>A, NG_009378.1:g.165992C>A, NM_002111.6:c.8679C>A, NM_002111.7:c.8679C>A, NP_002102.4:p.Leu2893, XM_005247964.1:c.8625C>A, XM_005247965.1:c.7959C>A, XP_005248021.1:p.Leu2875, XP_005248022.1:p.Leu2653
                                        20.

                                        rs781170352 [Homo sapiens]
                                          GGCCTACTGGAGCAAGTTGAATGAT[C/G]TGTTTGGTAATTAAAATTAAAATTT
                                          Chromosome:
                                          4:3212136
                                          Gene:
                                          HTT (GeneView)
                                          Functional Consequence:
                                          missense
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000004.11:g.3213863C>G, NC_000004.12:g.3212136C>G, NG_009378.1:g.142462C>G, NM_002111.6:c.6628C>G, NM_002111.7:c.6628C>G, NP_002102.4:p.Leu2210Val, XM_005247964.1:c.6574C>G, XM_005247965.1:c.5908C>G, XP_005248021.1:p.Leu2192Val, XP_005248022.1:p.Leu1970Val

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk