Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 291

1.

rs781726428 [Homo sapiens]
    CAAGATGCAAAAAGGTGAGCGCCAG[A/G]TGGCCAAAAGGTTCCTGGAGGAACG
    Chromosome:
    9:128471335
    Gene:
    ODF2 (GeneView)
    Functional Consequence:
    missense
    Validated:
    no info
    HGVS:
    NC_000009.11:g.131233614A>G, NC_000009.12:g.128471335A>G, NG_029568.1:g.21181A>G, NM_001242352.1:c.433A>G, NM_001242353.1:c.448A>G, NM_001242354.1:c.205A>G, NM_002540.4:c.376A>G, NM_153432.1:c.580A>G, NM_153433.1:c.448A>G, NM_153435.1:c.640A>G, NM_153436.1:c.448A>G, NM_153437.2:c.391A>G, NM_153439.1:c.523A>G, NM_153440.1:c.391A>G, NP_001229281.1:p.Met145Val, NP_001229282.1:p.Met150Val, NP_001229283.1:p.Met69Val, NP_002531.3:p.Met126Val, NP_702910.1:p.Met194Val, NP_702911.1:p.Met150Val, NP_702913.1:p.Met214Val, NP_702914.1:p.Met150Val, NP_702915.1:p.Met131Val, NP_702917.1:p.Met175Val, NP_702918.1:p.Met131Val, XM_005252010.1:c.580A>G, XM_005252011.1:c.523A>G, XM_005252012.1:c.448A>G, XM_005252012.2:c.448A>G, XM_005252013.1:c.448A>G, XM_005252013.2:c.448A>G, XM_005252014.1:c.448A>G, XM_005252014.2:c.448A>G, XM_005252015.1:c.448A>G, XM_005252016.1:c.448A>G, XM_005252016.2:c.448A>G, XM_005252017.1:c.433A>G, XM_005252017.3:c.433A>G, XM_005252018.1:c.433A>G, XM_005252019.1:c.433A>G, XM_005252019.2:c.433A>G, XM_005252020.1:c.433A>G, XM_005252020.2:c.433A>G, XM_005252021.1:c.409A>G, XM_005252022.1:c.391A>G, XM_005252023.1:c.391A>G, XM_005252024.1:c.391A>G, XM_005252024.2:c.391A>G, XM_005252025.1:c.391A>G, XM_005252026.1:c.376A>G, XM_005252026.3:c.376A>G, XM_005252027.1:c.376A>G, XM_005252027.2:c.376A>G, XM_005252028.1:c.262A>G, XM_005252029.1:c.391A>G, XM_005252030.1:c.-1965A>G, XM_006717126.2:c.448A>G, XM_011518722.1:c.697A>G, XM_011518723.1:c.640A>G, XM_011518724.1:c.565A>G, XM_011518725.1:c.565A>G, XM_011518726.1:c.565A>G, XM_011518727.1:c.565A>G, XM_011518728.1:c.565A>G, XM_011518729.1:c.565A>G, XM_011518730.1:c.697A>G, XM_011518731.1:c.526A>G, XM_011518732.1:c.508A>G, XM_011518733.1:c.469A>G, XM_011518734.1:c.454A>G, XM_011518735.1:c.448A>G, XM_011518736.1:c.433A>G, XM_011518737.1:c.391A>G, XM_011518738.1:c.352A>G, XM_011518739.1:c.322A>G, XM_011518740.1:c.322A>G, XM_011518741.1:c.277A>G, XM_011518742.1:c.220A>G, XM_011518743.1:c.205A>G, XM_011518744.1:c.523A>G, XP_005252067.1:p.Met194Val, XP_005252068.1:p.Met175Val, XP_005252069.1:p.Met150Val, XP_005252070.1:p.Met150Val, XP_005252071.1:p.Met150Val, XP_005252072.1:p.Met150Val, XP_005252073.1:p.Met150Val, XP_005252074.1:p.Met145Val, XP_005252075.1:p.Met145Val, XP_005252076.1:p.Met145Val, XP_005252077.1:p.Met145Val, XP_005252078.1:p.Met137Val, XP_005252079.1:p.Met131Val, XP_005252080.1:p.Met131Val, XP_005252081.1:p.Met131Val, XP_005252082.1:p.Met131Val, XP_005252083.1:p.Met126Val, XP_005252084.1:p.Met126Val, XP_005252085.1:p.Met88Val, XP_005252086.1:p.Met131Val, XP_006717189.1:p.Met150Val, XP_011517024.1:p.Met233Val, XP_011517025.1:p.Met214Val, XP_011517026.1:p.Met189Val, XP_011517027.1:p.Met189Val, XP_011517028.1:p.Met189Val, XP_011517029.1:p.Met189Val, XP_011517030.1:p.Met189Val, XP_011517031.1:p.Met189Val, XP_011517032.1:p.Met233Val, XP_011517033.1:p.Met176Val, XP_011517034.1:p.Met170Val, XP_011517035.1:p.Met157Val, XP_011517036.1:p.Met152Val, XP_011517037.1:p.Met150Val, XP_011517038.1:p.Met145Val, XP_011517039.1:p.Met131Val, XP_011517040.1:p.Met118Val, XP_011517041.1:p.Met108Val, XP_011517042.1:p.Met108Val, XP_011517043.1:p.Met93Val, XP_011517044.1:p.Met74Val, XP_011517045.1:p.Met69Val, XP_011517046.1:p.Met175Val
    2.

    rs781422660 [Homo sapiens]
      CTGAAGCTTTATCCACTCTGGAATC[C/G]TGGAGGAGCCGCTACAACCAAGTTG
      Chromosome:
      9:128485403
      Gene:
      ODF2 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      by frequency
      HGVS:
      NC_000009.11:g.131247682C>G, NC_000009.12:g.128485403C>G, NG_029568.1:g.35249C>G, NM_001242352.1:c.1314C>G, NM_001242353.1:c.1329C>G, NM_001242354.1:c.1086C>G, NM_002540.4:c.1257C>G, NM_153432.1:c.1461C>G, NM_153433.1:c.1329C>G, NM_153435.1:c.1521C>G, NM_153436.1:c.1329C>G, NM_153437.2:c.1272C>G, NM_153439.1:c.1404C>G, NM_153440.1:c.1272C>G, NP_001229281.1:p.Ser438, NP_001229282.1:p.Ser443, NP_001229283.1:p.Ser362, NP_002531.3:p.Ser419, NP_702910.1:p.Ser487, NP_702911.1:p.Ser443, NP_702913.1:p.Ser507, NP_702914.1:p.Ser443, NP_702915.1:p.Ser424, NP_702917.1:p.Ser468, NP_702918.1:p.Ser424, XM_005252010.1:c.1461C>G, XM_005252011.1:c.1404C>G, XM_005252012.1:c.1329C>G, XM_005252012.2:c.1329C>G, XM_005252013.1:c.1329C>G, XM_005252013.2:c.1329C>G, XM_005252014.1:c.1329C>G, XM_005252014.2:c.1329C>G, XM_005252015.1:c.1329C>G, XM_005252016.1:c.1329C>G, XM_005252016.2:c.1329C>G, XM_005252017.1:c.1314C>G, XM_005252017.3:c.1314C>G, XM_005252018.1:c.1314C>G, XM_005252019.1:c.1314C>G, XM_005252019.2:c.1314C>G, XM_005252020.1:c.1314C>G, XM_005252020.2:c.1314C>G, XM_005252021.1:c.1290C>G, XM_005252022.1:c.1272C>G, XM_005252023.1:c.1272C>G, XM_005252024.1:c.1272C>G, XM_005252024.2:c.1272C>G, XM_005252025.1:c.1272C>G, XM_005252026.1:c.1257C>G, XM_005252026.3:c.1257C>G, XM_005252027.1:c.1257C>G, XM_005252027.2:c.1257C>G, XM_005252028.1:c.1143C>G, XM_005252029.1:c.1272C>G, XM_005252030.1:c.609C>G, XM_006717126.2:c.1329C>G, XM_011518722.1:c.1578C>G, XM_011518723.1:c.1521C>G, XM_011518724.1:c.1446C>G, XM_011518725.1:c.1446C>G, XM_011518726.1:c.1446C>G, XM_011518727.1:c.1446C>G, XM_011518728.1:c.1446C>G, XM_011518729.1:c.1446C>G, XM_011518730.1:c.1578C>G, XM_011518731.1:c.1407C>G, XM_011518732.1:c.1389C>G, XM_011518733.1:c.1350C>G, XM_011518734.1:c.1335C>G, XM_011518735.1:c.1329C>G, XM_011518736.1:c.1314C>G, XM_011518737.1:c.1272C>G, XM_011518738.1:c.1233C>G, XM_011518739.1:c.1203C>G, XM_011518740.1:c.1203C>G, XM_011518741.1:c.1158C>G, XM_011518742.1:c.1101C>G, XM_011518743.1:c.1086C>G, XM_011518744.1:c.1404C>G, XP_005252067.1:p.Ser487, XP_005252068.1:p.Ser468, XP_005252069.1:p.Ser443, XP_005252070.1:p.Ser443, XP_005252071.1:p.Ser443, XP_005252072.1:p.Ser443, XP_005252073.1:p.Ser443, XP_005252074.1:p.Ser438, XP_005252075.1:p.Ser438, XP_005252076.1:p.Ser438, XP_005252077.1:p.Ser438, XP_005252078.1:p.Ser430, XP_005252079.1:p.Ser424, XP_005252080.1:p.Ser424, XP_005252081.1:p.Ser424, XP_005252082.1:p.Ser424, XP_005252083.1:p.Ser419, XP_005252084.1:p.Ser419, XP_005252085.1:p.Ser381, XP_005252086.1:p.Ser424, XP_005252087.1:p.Ser203, XP_006717189.1:p.Ser443, XP_011517024.1:p.Ser526, XP_011517025.1:p.Ser507, XP_011517026.1:p.Ser482, XP_011517027.1:p.Ser482, XP_011517028.1:p.Ser482, XP_011517029.1:p.Ser482, XP_011517030.1:p.Ser482, XP_011517031.1:p.Ser482, XP_011517032.1:p.Ser526, XP_011517033.1:p.Ser469, XP_011517034.1:p.Ser463, XP_011517035.1:p.Ser450, XP_011517036.1:p.Ser445, XP_011517037.1:p.Ser443, XP_011517038.1:p.Ser438, XP_011517039.1:p.Ser424, XP_011517040.1:p.Ser411, XP_011517041.1:p.Ser401, XP_011517042.1:p.Ser401, XP_011517043.1:p.Ser386, XP_011517044.1:p.Ser367, XP_011517045.1:p.Ser362, XP_011517046.1:p.Ser468
      3.

      rs781402056 [Homo sapiens]
        GCACCCTCCGAGACCTCCTGAGGGA[A/G]CAGCACTGCAAAGAGGTGAGCTTGG
        Chromosome:
        9:128473726
        Gene:
        ODF2 (GeneView)
        Functional Consequence:
        synonymous codon
        Validated:
        no info
        HGVS:
        NC_000009.11:g.131236005A>G, NC_000009.12:g.128473726A>G, NG_029568.1:g.23572A>G, NM_001242352.1:c.813A>G, NM_001242353.1:c.828A>G, NM_001242354.1:c.585A>G, NM_002540.4:c.756A>G, NM_153432.1:c.960A>G, NM_153433.1:c.828A>G, NM_153435.1:c.1020A>G, NM_153436.1:c.828A>G, NM_153437.2:c.771A>G, NM_153439.1:c.903A>G, NM_153440.1:c.771A>G, NP_001229281.1:p.Glu271, NP_001229282.1:p.Glu276, NP_001229283.1:p.Glu195, NP_002531.3:p.Glu252, NP_702910.1:p.Glu320, NP_702911.1:p.Glu276, NP_702913.1:p.Glu340, NP_702914.1:p.Glu276, NP_702915.1:p.Glu257, NP_702917.1:p.Glu301, NP_702918.1:p.Glu257, XM_005252010.1:c.960A>G, XM_005252011.1:c.903A>G, XM_005252012.1:c.828A>G, XM_005252012.2:c.828A>G, XM_005252013.1:c.828A>G, XM_005252013.2:c.828A>G, XM_005252014.1:c.828A>G, XM_005252014.2:c.828A>G, XM_005252015.1:c.828A>G, XM_005252016.1:c.828A>G, XM_005252016.2:c.828A>G, XM_005252017.1:c.813A>G, XM_005252017.3:c.813A>G, XM_005252018.1:c.813A>G, XM_005252019.1:c.813A>G, XM_005252019.2:c.813A>G, XM_005252020.1:c.813A>G, XM_005252020.2:c.813A>G, XM_005252021.1:c.789A>G, XM_005252022.1:c.771A>G, XM_005252023.1:c.771A>G, XM_005252024.1:c.771A>G, XM_005252024.2:c.771A>G, XM_005252025.1:c.771A>G, XM_005252026.1:c.756A>G, XM_005252026.3:c.756A>G, XM_005252027.1:c.756A>G, XM_005252027.2:c.756A>G, XM_005252028.1:c.642A>G, XM_005252029.1:c.771A>G, XM_005252030.1:c.108A>G, XM_006717126.2:c.828A>G, XM_011518722.1:c.1077A>G, XM_011518723.1:c.1020A>G, XM_011518724.1:c.945A>G, XM_011518725.1:c.945A>G, XM_011518726.1:c.945A>G, XM_011518727.1:c.945A>G, XM_011518728.1:c.945A>G, XM_011518729.1:c.945A>G, XM_011518730.1:c.1077A>G, XM_011518731.1:c.906A>G, XM_011518732.1:c.888A>G, XM_011518733.1:c.849A>G, XM_011518734.1:c.834A>G, XM_011518735.1:c.828A>G, XM_011518736.1:c.813A>G, XM_011518737.1:c.771A>G, XM_011518738.1:c.732A>G, XM_011518739.1:c.702A>G, XM_011518740.1:c.702A>G, XM_011518741.1:c.657A>G, XM_011518742.1:c.600A>G, XM_011518743.1:c.585A>G, XM_011518744.1:c.903A>G, XP_005252067.1:p.Glu320, XP_005252068.1:p.Glu301, XP_005252069.1:p.Glu276, XP_005252070.1:p.Glu276, XP_005252071.1:p.Glu276, XP_005252072.1:p.Glu276, XP_005252073.1:p.Glu276, XP_005252074.1:p.Glu271, XP_005252075.1:p.Glu271, XP_005252076.1:p.Glu271, XP_005252077.1:p.Glu271, XP_005252078.1:p.Glu263, XP_005252079.1:p.Glu257, XP_005252080.1:p.Glu257, XP_005252081.1:p.Glu257, XP_005252082.1:p.Glu257, XP_005252083.1:p.Glu252, XP_005252084.1:p.Glu252, XP_005252085.1:p.Glu214, XP_005252086.1:p.Glu257, XP_005252087.1:p.Glu36, XP_006717189.1:p.Glu276, XP_011517024.1:p.Glu359, XP_011517025.1:p.Glu340, XP_011517026.1:p.Glu315, XP_011517027.1:p.Glu315, XP_011517028.1:p.Glu315, XP_011517029.1:p.Glu315, XP_011517030.1:p.Glu315, XP_011517031.1:p.Glu315, XP_011517032.1:p.Glu359, XP_011517033.1:p.Glu302, XP_011517034.1:p.Glu296, XP_011517035.1:p.Glu283, XP_011517036.1:p.Glu278, XP_011517037.1:p.Glu276, XP_011517038.1:p.Glu271, XP_011517039.1:p.Glu257, XP_011517040.1:p.Glu244, XP_011517041.1:p.Glu234, XP_011517042.1:p.Glu234, XP_011517043.1:p.Glu219, XP_011517044.1:p.Glu200, XP_011517045.1:p.Glu195, XP_011517046.1:p.Glu301
        4.

        rs780917763 [Homo sapiens]
          AAGGCCATCCGAGCCCAGAAGGAGC[A/G]AGCCGAGAAGAGCGAGGAGTATGCT
          Chromosome:
          9:128484831
          Gene:
          ODF2 (GeneView)
          Functional Consequence:
          missense
          Validated:
          no info
          HGVS:
          NC_000009.11:g.131247110G>A, NC_000009.12:g.128484831G>A, NG_029568.1:g.34677G>A, NM_001242352.1:c.1220G>A, NM_001242353.1:c.1235G>A, NM_001242354.1:c.992G>A, NM_002540.4:c.1163G>A, NM_153432.1:c.1367G>A, NM_153433.1:c.1235G>A, NM_153435.1:c.1427G>A, NM_153436.1:c.1235G>A, NM_153437.2:c.1178G>A, NM_153439.1:c.1310G>A, NM_153440.1:c.1178G>A, NP_001229281.1:p.Arg407Gln, NP_001229282.1:p.Arg412Gln, NP_001229283.1:p.Arg331Gln, NP_002531.3:p.Arg388Gln, NP_702910.1:p.Arg456Gln, NP_702911.1:p.Arg412Gln, NP_702913.1:p.Arg476Gln, NP_702914.1:p.Arg412Gln, NP_702915.1:p.Arg393Gln, NP_702917.1:p.Arg437Gln, NP_702918.1:p.Arg393Gln, XM_005252010.1:c.1367G>A, XM_005252011.1:c.1310G>A, XM_005252012.1:c.1235G>A, XM_005252012.2:c.1235G>A, XM_005252013.1:c.1235G>A, XM_005252013.2:c.1235G>A, XM_005252014.1:c.1235G>A, XM_005252014.2:c.1235G>A, XM_005252015.1:c.1235G>A, XM_005252016.1:c.1235G>A, XM_005252016.2:c.1235G>A, XM_005252017.1:c.1220G>A, XM_005252017.3:c.1220G>A, XM_005252018.1:c.1220G>A, XM_005252019.1:c.1220G>A, XM_005252019.2:c.1220G>A, XM_005252020.1:c.1220G>A, XM_005252020.2:c.1220G>A, XM_005252021.1:c.1196G>A, XM_005252022.1:c.1178G>A, XM_005252023.1:c.1178G>A, XM_005252024.1:c.1178G>A, XM_005252024.2:c.1178G>A, XM_005252025.1:c.1178G>A, XM_005252026.1:c.1163G>A, XM_005252026.3:c.1163G>A, XM_005252027.1:c.1163G>A, XM_005252027.2:c.1163G>A, XM_005252028.1:c.1049G>A, XM_005252029.1:c.1178G>A, XM_005252030.1:c.515G>A, XM_006717126.2:c.1235G>A, XM_011518722.1:c.1484G>A, XM_011518723.1:c.1427G>A, XM_011518724.1:c.1352G>A, XM_011518725.1:c.1352G>A, XM_011518726.1:c.1352G>A, XM_011518727.1:c.1352G>A, XM_011518728.1:c.1352G>A, XM_011518729.1:c.1352G>A, XM_011518730.1:c.1484G>A, XM_011518731.1:c.1313G>A, XM_011518732.1:c.1295G>A, XM_011518733.1:c.1256G>A, XM_011518734.1:c.1241G>A, XM_011518735.1:c.1235G>A, XM_011518736.1:c.1220G>A, XM_011518737.1:c.1178G>A, XM_011518738.1:c.1139G>A, XM_011518739.1:c.1109G>A, XM_011518740.1:c.1109G>A, XM_011518741.1:c.1064G>A, XM_011518742.1:c.1007G>A, XM_011518743.1:c.992G>A, XM_011518744.1:c.1310G>A, XP_005252067.1:p.Arg456Gln, XP_005252068.1:p.Arg437Gln, XP_005252069.1:p.Arg412Gln, XP_005252070.1:p.Arg412Gln, XP_005252071.1:p.Arg412Gln, XP_005252072.1:p.Arg412Gln, XP_005252073.1:p.Arg412Gln, XP_005252074.1:p.Arg407Gln, XP_005252075.1:p.Arg407Gln, XP_005252076.1:p.Arg407Gln, XP_005252077.1:p.Arg407Gln, XP_005252078.1:p.Arg399Gln, XP_005252079.1:p.Arg393Gln, XP_005252080.1:p.Arg393Gln, XP_005252081.1:p.Arg393Gln, XP_005252082.1:p.Arg393Gln, XP_005252083.1:p.Arg388Gln, XP_005252084.1:p.Arg388Gln, XP_005252085.1:p.Arg350Gln, XP_005252086.1:p.Arg393Gln, XP_005252087.1:p.Arg172Gln, XP_006717189.1:p.Arg412Gln, XP_011517024.1:p.Arg495Gln, XP_011517025.1:p.Arg476Gln, XP_011517026.1:p.Arg451Gln, XP_011517027.1:p.Arg451Gln, XP_011517028.1:p.Arg451Gln, XP_011517029.1:p.Arg451Gln, XP_011517030.1:p.Arg451Gln, XP_011517031.1:p.Arg451Gln, XP_011517032.1:p.Arg495Gln, XP_011517033.1:p.Arg438Gln, XP_011517034.1:p.Arg432Gln, XP_011517035.1:p.Arg419Gln, XP_011517036.1:p.Arg414Gln, XP_011517037.1:p.Arg412Gln, XP_011517038.1:p.Arg407Gln, XP_011517039.1:p.Arg393Gln, XP_011517040.1:p.Arg380Gln, XP_011517041.1:p.Arg370Gln, XP_011517042.1:p.Arg370Gln, XP_011517043.1:p.Arg355Gln, XP_011517044.1:p.Arg336Gln, XP_011517045.1:p.Arg331Gln, XP_011517046.1:p.Arg437Gln
          5.

          rs780846935 [Homo sapiens]
            ACGGTGTTGAGGCACAACATCGAGC[G/T]CATGAAGGAGGAGAAGGACTTCACC
            Chromosome:
            9:128471441
            Gene:
            ODF2 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by frequency
            HGVS:
            NC_000009.11:g.131233720G>T, NC_000009.12:g.128471441G>T, NG_029568.1:g.21287G>T, NM_001242352.1:c.539G>T, NM_001242353.1:c.554G>T, NM_001242354.1:c.311G>T, NM_002540.4:c.482G>T, NM_153432.1:c.686G>T, NM_153433.1:c.554G>T, NM_153435.1:c.746G>T, NM_153436.1:c.554G>T, NM_153437.2:c.497G>T, NM_153439.1:c.629G>T, NM_153440.1:c.497G>T, NP_001229281.1:p.Arg180Leu, NP_001229282.1:p.Arg185Leu, NP_001229283.1:p.Arg104Leu, NP_002531.3:p.Arg161Leu, NP_702910.1:p.Arg229Leu, NP_702911.1:p.Arg185Leu, NP_702913.1:p.Arg249Leu, NP_702914.1:p.Arg185Leu, NP_702915.1:p.Arg166Leu, NP_702917.1:p.Arg210Leu, NP_702918.1:p.Arg166Leu, XM_005252010.1:c.686G>T, XM_005252011.1:c.629G>T, XM_005252012.1:c.554G>T, XM_005252012.2:c.554G>T, XM_005252013.1:c.554G>T, XM_005252013.2:c.554G>T, XM_005252014.1:c.554G>T, XM_005252014.2:c.554G>T, XM_005252015.1:c.554G>T, XM_005252016.1:c.554G>T, XM_005252016.2:c.554G>T, XM_005252017.1:c.539G>T, XM_005252017.3:c.539G>T, XM_005252018.1:c.539G>T, XM_005252019.1:c.539G>T, XM_005252019.2:c.539G>T, XM_005252020.1:c.539G>T, XM_005252020.2:c.539G>T, XM_005252021.1:c.515G>T, XM_005252022.1:c.497G>T, XM_005252023.1:c.497G>T, XM_005252024.1:c.497G>T, XM_005252024.2:c.497G>T, XM_005252025.1:c.497G>T, XM_005252026.1:c.482G>T, XM_005252026.3:c.482G>T, XM_005252027.1:c.482G>T, XM_005252027.2:c.482G>T, XM_005252028.1:c.368G>T, XM_005252029.1:c.497G>T, XM_005252030.1:c.-1859G>T, XM_006717126.2:c.554G>T, XM_011518722.1:c.803G>T, XM_011518723.1:c.746G>T, XM_011518724.1:c.671G>T, XM_011518725.1:c.671G>T, XM_011518726.1:c.671G>T, XM_011518727.1:c.671G>T, XM_011518728.1:c.671G>T, XM_011518729.1:c.671G>T, XM_011518730.1:c.803G>T, XM_011518731.1:c.632G>T, XM_011518732.1:c.614G>T, XM_011518733.1:c.575G>T, XM_011518734.1:c.560G>T, XM_011518735.1:c.554G>T, XM_011518736.1:c.539G>T, XM_011518737.1:c.497G>T, XM_011518738.1:c.458G>T, XM_011518739.1:c.428G>T, XM_011518740.1:c.428G>T, XM_011518741.1:c.383G>T, XM_011518742.1:c.326G>T, XM_011518743.1:c.311G>T, XM_011518744.1:c.629G>T, XP_005252067.1:p.Arg229Leu, XP_005252068.1:p.Arg210Leu, XP_005252069.1:p.Arg185Leu, XP_005252070.1:p.Arg185Leu, XP_005252071.1:p.Arg185Leu, XP_005252072.1:p.Arg185Leu, XP_005252073.1:p.Arg185Leu, XP_005252074.1:p.Arg180Leu, XP_005252075.1:p.Arg180Leu, XP_005252076.1:p.Arg180Leu, XP_005252077.1:p.Arg180Leu, XP_005252078.1:p.Arg172Leu, XP_005252079.1:p.Arg166Leu, XP_005252080.1:p.Arg166Leu, XP_005252081.1:p.Arg166Leu, XP_005252082.1:p.Arg166Leu, XP_005252083.1:p.Arg161Leu, XP_005252084.1:p.Arg161Leu, XP_005252085.1:p.Arg123Leu, XP_005252086.1:p.Arg166Leu, XP_006717189.1:p.Arg185Leu, XP_011517024.1:p.Arg268Leu, XP_011517025.1:p.Arg249Leu, XP_011517026.1:p.Arg224Leu, XP_011517027.1:p.Arg224Leu, XP_011517028.1:p.Arg224Leu, XP_011517029.1:p.Arg224Leu, XP_011517030.1:p.Arg224Leu, XP_011517031.1:p.Arg224Leu, XP_011517032.1:p.Arg268Leu, XP_011517033.1:p.Arg211Leu, XP_011517034.1:p.Arg205Leu, XP_011517035.1:p.Arg192Leu, XP_011517036.1:p.Arg187Leu, XP_011517037.1:p.Arg185Leu, XP_011517038.1:p.Arg180Leu, XP_011517039.1:p.Arg166Leu, XP_011517040.1:p.Arg153Leu, XP_011517041.1:p.Arg143Leu, XP_011517042.1:p.Arg143Leu, XP_011517043.1:p.Arg128Leu, XP_011517044.1:p.Arg109Leu, XP_011517045.1:p.Arg104Leu, XP_011517046.1:p.Arg210Leu
            6.

            rs780835655 [Homo sapiens]
              CCTGAAGATCACGGAGGCGAAGCTG[A/G]CTGAGTGCCAAGACCAACTGCAGGG
              Chromosome:
              9:128494588
              Gene:
              ODF2 (GeneView)
              Functional Consequence:
              missense
              Validated:
              no info
              HGVS:
              NC_000009.11:g.131256867G>A, NC_000009.12:g.128494588G>A, NG_029568.1:g.44434G>A, NM_001242352.1:c.1816G>A, NM_001242353.1:c.1831G>A, NM_001242354.1:c.1588G>A, NM_002540.4:c.1759G>A, NM_153432.1:c.1963G>A, NM_153433.1:c.1831G>A, NM_153435.1:c.2023G>A, NM_153436.1:c.1831G>A, NM_153437.2:c.1774G>A, NM_153439.1:c.1819G>A, NM_153440.1:c.1774G>A, NP_001229281.1:p.Ala606Thr, NP_001229282.1:p.Ala611Thr, NP_001229283.1:p.Ala530Thr, NP_002531.3:p.Ala587Thr, NP_702910.1:p.Ala655Thr, NP_702911.1:p.Ala611Thr, NP_702913.1:p.Ala675Thr, NP_702914.1:p.Ala611Thr, NP_702915.1:p.Ala592Thr, NP_702917.1:p.Ala607Thr, NP_702918.1:p.Ala592Thr, XM_005252010.1:c.1963G>A, XM_005252011.1:c.1906G>A, XM_005252012.1:c.1831G>A, XM_005252012.2:c.1831G>A, XM_005252013.1:c.1831G>A, XM_005252013.2:c.1831G>A, XM_005252014.1:c.1831G>A, XM_005252014.2:c.1831G>A, XM_005252015.1:c.1831G>A, XM_005252016.1:c.1831G>A, XM_005252016.2:c.1831G>A, XM_005252017.1:c.1816G>A, XM_005252017.3:c.1816G>A, XM_005252018.1:c.1816G>A, XM_005252019.1:c.1816G>A, XM_005252019.2:c.1816G>A, XM_005252020.1:c.1816G>A, XM_005252020.2:c.1816G>A, XM_005252021.1:c.1792G>A, XM_005252022.1:c.1774G>A, XM_005252023.1:c.1774G>A, XM_005252024.1:c.1774G>A, XM_005252024.2:c.1774G>A, XM_005252025.1:c.1774G>A, XM_005252026.1:c.1759G>A, XM_005252026.3:c.1759G>A, XM_005252027.1:c.1759G>A, XM_005252027.2:c.1759G>A, XM_005252028.1:c.1645G>A, XM_005252029.1:c.1774G>A, XM_005252030.1:c.1111G>A, XM_006717126.2:c.1831G>A, XM_011518722.1:c.2080G>A, XM_011518723.1:c.2023G>A, XM_011518724.1:c.1948G>A, XM_011518725.1:c.1948G>A, XM_011518726.1:c.1948G>A, XM_011518727.1:c.1948G>A, XM_011518728.1:c.1948G>A, XM_011518729.1:c.1948G>A, XM_011518730.1:c.2080G>A, XM_011518731.1:c.1909G>A, XM_011518732.1:c.1891G>A, XM_011518733.1:c.1852G>A, XM_011518734.1:c.1837G>A, XM_011518735.1:c.1831G>A, XM_011518736.1:c.1816G>A, XM_011518737.1:c.1774G>A, XM_011518738.1:c.1735G>A, XM_011518739.1:c.1705G>A, XM_011518740.1:c.1705G>A, XM_011518741.1:c.1660G>A, XM_011518742.1:c.1603G>A, XM_011518743.1:c.1588G>A, XM_011518744.1:c.1906G>A, XP_005252067.1:p.Ala655Thr, XP_005252068.1:p.Ala636Thr, XP_005252069.1:p.Ala611Thr, XP_005252070.1:p.Ala611Thr, XP_005252071.1:p.Ala611Thr, XP_005252072.1:p.Ala611Thr, XP_005252073.1:p.Ala611Thr, XP_005252074.1:p.Ala606Thr, XP_005252075.1:p.Ala606Thr, XP_005252076.1:p.Ala606Thr, XP_005252077.1:p.Ala606Thr, XP_005252078.1:p.Ala598Thr, XP_005252079.1:p.Ala592Thr, XP_005252080.1:p.Ala592Thr, XP_005252081.1:p.Ala592Thr, XP_005252082.1:p.Ala592Thr, XP_005252083.1:p.Ala587Thr, XP_005252084.1:p.Ala587Thr, XP_005252085.1:p.Ala549Thr, XP_005252086.1:p.Ala592Thr, XP_005252087.1:p.Ala371Thr, XP_006717189.1:p.Ala611Thr, XP_011517024.1:p.Ala694Thr, XP_011517025.1:p.Ala675Thr, XP_011517026.1:p.Ala650Thr, XP_011517027.1:p.Ala650Thr, XP_011517028.1:p.Ala650Thr, XP_011517029.1:p.Ala650Thr, XP_011517030.1:p.Ala650Thr, XP_011517031.1:p.Ala650Thr, XP_011517032.1:p.Ala694Thr, XP_011517033.1:p.Ala637Thr, XP_011517034.1:p.Ala631Thr, XP_011517035.1:p.Ala618Thr, XP_011517036.1:p.Ala613Thr, XP_011517037.1:p.Ala611Thr, XP_011517038.1:p.Ala606Thr, XP_011517039.1:p.Ala592Thr, XP_011517040.1:p.Ala579Thr, XP_011517041.1:p.Ala569Thr, XP_011517042.1:p.Ala569Thr, XP_011517043.1:p.Ala554Thr, XP_011517044.1:p.Ala535Thr, XP_011517045.1:p.Ala530Thr, XP_011517046.1:p.Ala636Thr
              7.

              rs780721900 [Homo sapiens]
                TGTGGCGCACCCAGTGTAACTGTGA[C/G/T]GGTAGGTGATGCACTCACGTAGCAG
                Chromosome:
                9:128459656
                Gene:
                ODF2 (GeneView)
                Functional Consequence:
                missense,upstream variant 2KB,utr variant 5 prime
                Validated:
                by cluster,by frequency
                HGVS:
                NC_000009.11:g.131221935C>T, NC_000009.12:g.128459656C>T, NG_029568.1:g.9502C>T, NM_001242352.1:c.-48C>T, NM_001242353.1:c.122C>T, NM_001242354.1:c.-48C>T, NM_002540.4:c.-153C>T, NM_153432.1:c.254C>T, NM_153433.1:c.122C>T, NM_153435.1:c.254C>T, NM_153436.1:c.122C>T, NM_153437.2:c.122C>T, NM_153439.1:c.254C>T, NM_153440.1:c.122C>T, NP_001229282.1:p.Thr41Met, NP_702910.1:p.Thr85Met, NP_702911.1:p.Thr41Met, NP_702913.1:p.Thr85Met, NP_702914.1:p.Thr41Met, NP_702915.1:p.Thr41Met, NP_702917.1:p.Thr85Met, NP_702918.1:p.Thr41Met, XM_005252010.1:c.254C>T, XM_005252011.1:c.254C>T, XM_005252012.1:c.122C>T, XM_005252012.2:c.122C>T, XM_005252013.1:c.122C>T, XM_005252013.2:c.122C>T, XM_005252014.1:c.122C>T, XM_005252014.2:c.122C>T, XM_005252015.1:c.122C>T, XM_005252016.1:c.122C>T, XM_005252016.2:c.122C>T, XM_005252017.1:c.-48C>T, XM_005252017.3:c.-48C>T, XM_005252018.1:c.-48C>T, XM_005252019.1:c.-48C>T, XM_005252019.2:c.-48C>T, XM_005252020.1:c.-48C>T, XM_005252020.2:c.-48C>T, XM_005252021.1:c.254C>T, XM_005252022.1:c.122C>T, XM_005252023.1:c.122C>T, XM_005252024.1:c.122C>T, XM_005252024.2:c.122C>T, XM_005252025.1:c.122C>T, XM_005252026.1:c.-48C>T, XM_005252026.3:c.-48C>T, XM_005252027.1:c.-48C>T, XM_005252027.2:c.-48C>T, XM_005252028.1:c.-48C>T, XM_005252029.1:c.122C>T, XM_006717126.2:c.122C>T, XM_011518722.1:c.254C>T, XM_011518723.1:c.254C>T, XM_011518724.1:c.122C>T, XM_011518725.1:c.122C>T, XM_011518726.1:c.122C>T, XM_011518727.1:c.122C>T, XM_011518728.1:c.122C>T, XM_011518729.1:c.122C>T, XM_011518730.1:c.254C>T, XM_011518731.1:c.254C>T, XM_011518732.1:c.122C>T, XM_011518733.1:c.254C>T, XM_011518734.1:c.254C>T, XM_011518735.1:c.122C>T, XM_011518736.1:c.-690C>T, XM_011518737.1:c.122C>T, XM_011518738.1:c.254C>T, XM_011518739.1:c.122C>T, XM_011518740.1:c.122C>T, XM_011518741.1:c.122C>T, XM_011518742.1:c.122C>T, XM_011518743.1:c.-48C>T, XM_011518744.1:c.254C>T, XP_005252067.1:p.Thr85Met, XP_005252068.1:p.Thr85Met, XP_005252069.1:p.Thr41Met, XP_005252070.1:p.Thr41Met, XP_005252071.1:p.Thr41Met, XP_005252072.1:p.Thr41Met, XP_005252073.1:p.Thr41Met, XP_005252078.1:p.Thr85Met, XP_005252079.1:p.Thr41Met, XP_005252080.1:p.Thr41Met, XP_005252081.1:p.Thr41Met, XP_005252082.1:p.Thr41Met, XP_005252086.1:p.Thr41Met, XP_006717189.1:p.Thr41Met, XP_011517024.1:p.Thr85Met, XP_011517025.1:p.Thr85Met, XP_011517026.1:p.Thr41Met, XP_011517027.1:p.Thr41Met, XP_011517028.1:p.Thr41Met, XP_011517029.1:p.Thr41Met, XP_011517030.1:p.Thr41Met, XP_011517031.1:p.Thr41Met, XP_011517032.1:p.Thr85Met, XP_011517033.1:p.Thr85Met, XP_011517034.1:p.Thr41Met, XP_011517035.1:p.Thr85Met, XP_011517036.1:p.Thr85Met, XP_011517037.1:p.Thr41Met, XP_011517039.1:p.Thr41Met, XP_011517040.1:p.Thr85Met, XP_011517041.1:p.Thr41Met, XP_011517042.1:p.Thr41Met, XP_011517043.1:p.Thr41Met, XP_011517044.1:p.Thr41Met, XP_011517046.1:p.Thr85Met
                8.

                rs780716524 [Homo sapiens]
                  AGCGCCAGATGGCCAAAAGGTTCCT[A/G]GAGGAACGGAAGGAAGAGCTGGAGG
                  Chromosome:
                  9:128471352
                  Gene:
                  ODF2 (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  no info
                  HGVS:
                  NC_000009.11:g.131233631G>A, NC_000009.12:g.128471352G>A, NG_029568.1:g.21198G>A, NM_001242352.1:c.450G>A, NM_001242353.1:c.465G>A, NM_001242354.1:c.222G>A, NM_002540.4:c.393G>A, NM_153432.1:c.597G>A, NM_153433.1:c.465G>A, NM_153435.1:c.657G>A, NM_153436.1:c.465G>A, NM_153437.2:c.408G>A, NM_153439.1:c.540G>A, NM_153440.1:c.408G>A, NP_001229281.1:p.Leu150, NP_001229282.1:p.Leu155, NP_001229283.1:p.Leu74, NP_002531.3:p.Leu131, NP_702910.1:p.Leu199, NP_702911.1:p.Leu155, NP_702913.1:p.Leu219, NP_702914.1:p.Leu155, NP_702915.1:p.Leu136, NP_702917.1:p.Leu180, NP_702918.1:p.Leu136, XM_005252010.1:c.597G>A, XM_005252011.1:c.540G>A, XM_005252012.1:c.465G>A, XM_005252012.2:c.465G>A, XM_005252013.1:c.465G>A, XM_005252013.2:c.465G>A, XM_005252014.1:c.465G>A, XM_005252014.2:c.465G>A, XM_005252015.1:c.465G>A, XM_005252016.1:c.465G>A, XM_005252016.2:c.465G>A, XM_005252017.1:c.450G>A, XM_005252017.3:c.450G>A, XM_005252018.1:c.450G>A, XM_005252019.1:c.450G>A, XM_005252019.2:c.450G>A, XM_005252020.1:c.450G>A, XM_005252020.2:c.450G>A, XM_005252021.1:c.426G>A, XM_005252022.1:c.408G>A, XM_005252023.1:c.408G>A, XM_005252024.1:c.408G>A, XM_005252024.2:c.408G>A, XM_005252025.1:c.408G>A, XM_005252026.1:c.393G>A, XM_005252026.3:c.393G>A, XM_005252027.1:c.393G>A, XM_005252027.2:c.393G>A, XM_005252028.1:c.279G>A, XM_005252029.1:c.408G>A, XM_005252030.1:c.-1948G>A, XM_006717126.2:c.465G>A, XM_011518722.1:c.714G>A, XM_011518723.1:c.657G>A, XM_011518724.1:c.582G>A, XM_011518725.1:c.582G>A, XM_011518726.1:c.582G>A, XM_011518727.1:c.582G>A, XM_011518728.1:c.582G>A, XM_011518729.1:c.582G>A, XM_011518730.1:c.714G>A, XM_011518731.1:c.543G>A, XM_011518732.1:c.525G>A, XM_011518733.1:c.486G>A, XM_011518734.1:c.471G>A, XM_011518735.1:c.465G>A, XM_011518736.1:c.450G>A, XM_011518737.1:c.408G>A, XM_011518738.1:c.369G>A, XM_011518739.1:c.339G>A, XM_011518740.1:c.339G>A, XM_011518741.1:c.294G>A, XM_011518742.1:c.237G>A, XM_011518743.1:c.222G>A, XM_011518744.1:c.540G>A, XP_005252067.1:p.Leu199, XP_005252068.1:p.Leu180, XP_005252069.1:p.Leu155, XP_005252070.1:p.Leu155, XP_005252071.1:p.Leu155, XP_005252072.1:p.Leu155, XP_005252073.1:p.Leu155, XP_005252074.1:p.Leu150, XP_005252075.1:p.Leu150, XP_005252076.1:p.Leu150, XP_005252077.1:p.Leu150, XP_005252078.1:p.Leu142, XP_005252079.1:p.Leu136, XP_005252080.1:p.Leu136, XP_005252081.1:p.Leu136, XP_005252082.1:p.Leu136, XP_005252083.1:p.Leu131, XP_005252084.1:p.Leu131, XP_005252085.1:p.Leu93, XP_005252086.1:p.Leu136, XP_006717189.1:p.Leu155, XP_011517024.1:p.Leu238, XP_011517025.1:p.Leu219, XP_011517026.1:p.Leu194, XP_011517027.1:p.Leu194, XP_011517028.1:p.Leu194, XP_011517029.1:p.Leu194, XP_011517030.1:p.Leu194, XP_011517031.1:p.Leu194, XP_011517032.1:p.Leu238, XP_011517033.1:p.Leu181, XP_011517034.1:p.Leu175, XP_011517035.1:p.Leu162, XP_011517036.1:p.Leu157, XP_011517037.1:p.Leu155, XP_011517038.1:p.Leu150, XP_011517039.1:p.Leu136, XP_011517040.1:p.Leu123, XP_011517041.1:p.Leu113, XP_011517042.1:p.Leu113, XP_011517043.1:p.Leu98, XP_011517044.1:p.Leu79, XP_011517045.1:p.Leu74, XP_011517046.1:p.Leu180
                  9.

                  rs780614239 [Homo sapiens]
                    CACGCAGAAAAAGGTCTTGAGAGCA[A/C]CTTGTGGCGCACCCAGTGTAACTGT
                    Chromosome:
                    9:128459628
                    Gene:
                    ODF2 (GeneView)
                    Functional Consequence:
                    missense,upstream variant 2KB,utr variant 5 prime
                    Validated:
                    no info
                    HGVS:
                    NC_000009.11:g.131221907C>A, NC_000009.12:g.128459628C>A, NG_029568.1:g.9474C>A, NM_001242352.1:c.-76C>A, NM_001242353.1:c.94C>A, NM_001242354.1:c.-76C>A, NM_002540.4:c.-181C>A, NM_153432.1:c.226C>A, NM_153433.1:c.94C>A, NM_153435.1:c.226C>A, NM_153436.1:c.94C>A, NM_153437.2:c.94C>A, NM_153439.1:c.226C>A, NM_153440.1:c.94C>A, NP_001229282.1:p.Pro32Thr, NP_702910.1:p.Pro76Thr, NP_702911.1:p.Pro32Thr, NP_702913.1:p.Pro76Thr, NP_702914.1:p.Pro32Thr, NP_702915.1:p.Pro32Thr, NP_702917.1:p.Pro76Thr, NP_702918.1:p.Pro32Thr, XM_005252010.1:c.226C>A, XM_005252011.1:c.226C>A, XM_005252012.1:c.94C>A, XM_005252012.2:c.94C>A, XM_005252013.1:c.94C>A, XM_005252013.2:c.94C>A, XM_005252014.1:c.94C>A, XM_005252014.2:c.94C>A, XM_005252015.1:c.94C>A, XM_005252016.1:c.94C>A, XM_005252016.2:c.94C>A, XM_005252017.1:c.-76C>A, XM_005252017.3:c.-76C>A, XM_005252018.1:c.-76C>A, XM_005252019.1:c.-76C>A, XM_005252019.2:c.-76C>A, XM_005252020.1:c.-76C>A, XM_005252020.2:c.-76C>A, XM_005252021.1:c.226C>A, XM_005252022.1:c.94C>A, XM_005252023.1:c.94C>A, XM_005252024.1:c.94C>A, XM_005252024.2:c.94C>A, XM_005252025.1:c.94C>A, XM_005252026.1:c.-76C>A, XM_005252026.3:c.-76C>A, XM_005252027.1:c.-76C>A, XM_005252027.2:c.-76C>A, XM_005252028.1:c.-76C>A, XM_005252029.1:c.94C>A, XM_006717126.2:c.94C>A, XM_011518722.1:c.226C>A, XM_011518723.1:c.226C>A, XM_011518724.1:c.94C>A, XM_011518725.1:c.94C>A, XM_011518726.1:c.94C>A, XM_011518727.1:c.94C>A, XM_011518728.1:c.94C>A, XM_011518729.1:c.94C>A, XM_011518730.1:c.226C>A, XM_011518731.1:c.226C>A, XM_011518732.1:c.94C>A, XM_011518733.1:c.226C>A, XM_011518734.1:c.226C>A, XM_011518735.1:c.94C>A, XM_011518736.1:c.-718C>A, XM_011518737.1:c.94C>A, XM_011518738.1:c.226C>A, XM_011518739.1:c.94C>A, XM_011518740.1:c.94C>A, XM_011518741.1:c.94C>A, XM_011518742.1:c.94C>A, XM_011518743.1:c.-76C>A, XM_011518744.1:c.226C>A, XP_005252067.1:p.Pro76Thr, XP_005252068.1:p.Pro76Thr, XP_005252069.1:p.Pro32Thr, XP_005252070.1:p.Pro32Thr, XP_005252071.1:p.Pro32Thr, XP_005252072.1:p.Pro32Thr, XP_005252073.1:p.Pro32Thr, XP_005252078.1:p.Pro76Thr, XP_005252079.1:p.Pro32Thr, XP_005252080.1:p.Pro32Thr, XP_005252081.1:p.Pro32Thr, XP_005252082.1:p.Pro32Thr, XP_005252086.1:p.Pro32Thr, XP_006717189.1:p.Pro32Thr, XP_011517024.1:p.Pro76Thr, XP_011517025.1:p.Pro76Thr, XP_011517026.1:p.Pro32Thr, XP_011517027.1:p.Pro32Thr, XP_011517028.1:p.Pro32Thr, XP_011517029.1:p.Pro32Thr, XP_011517030.1:p.Pro32Thr, XP_011517031.1:p.Pro32Thr, XP_011517032.1:p.Pro76Thr, XP_011517033.1:p.Pro76Thr, XP_011517034.1:p.Pro32Thr, XP_011517035.1:p.Pro76Thr, XP_011517036.1:p.Pro76Thr, XP_011517037.1:p.Pro32Thr, XP_011517039.1:p.Pro32Thr, XP_011517040.1:p.Pro76Thr, XP_011517041.1:p.Pro32Thr, XP_011517042.1:p.Pro32Thr, XP_011517043.1:p.Pro32Thr, XP_011517044.1:p.Pro32Thr, XP_011517046.1:p.Pro76Thr
                    10.

                    rs780524473 [Homo sapiens]
                      CTGAGACTGAGCACGAGAACACGGT[G/T]TTGAGGCACAACATCGAGCGCATGA
                      Chromosome:
                      9:128471421
                      Gene:
                      ODF2 (GeneView)
                      Functional Consequence:
                      synonymous codon
                      Validated:
                      by frequency
                      HGVS:
                      NC_000009.11:g.131233700G>T, NC_000009.12:g.128471421G>T, NG_029568.1:g.21267G>T, NM_001242352.1:c.519G>T, NM_001242353.1:c.534G>T, NM_001242354.1:c.291G>T, NM_002540.4:c.462G>T, NM_153432.1:c.666G>T, NM_153433.1:c.534G>T, NM_153435.1:c.726G>T, NM_153436.1:c.534G>T, NM_153437.2:c.477G>T, NM_153439.1:c.609G>T, NM_153440.1:c.477G>T, NP_001229281.1:p.Val173, NP_001229282.1:p.Val178, NP_001229283.1:p.Val97, NP_002531.3:p.Val154, NP_702910.1:p.Val222, NP_702911.1:p.Val178, NP_702913.1:p.Val242, NP_702914.1:p.Val178, NP_702915.1:p.Val159, NP_702917.1:p.Val203, NP_702918.1:p.Val159, XM_005252010.1:c.666G>T, XM_005252011.1:c.609G>T, XM_005252012.1:c.534G>T, XM_005252012.2:c.534G>T, XM_005252013.1:c.534G>T, XM_005252013.2:c.534G>T, XM_005252014.1:c.534G>T, XM_005252014.2:c.534G>T, XM_005252015.1:c.534G>T, XM_005252016.1:c.534G>T, XM_005252016.2:c.534G>T, XM_005252017.1:c.519G>T, XM_005252017.3:c.519G>T, XM_005252018.1:c.519G>T, XM_005252019.1:c.519G>T, XM_005252019.2:c.519G>T, XM_005252020.1:c.519G>T, XM_005252020.2:c.519G>T, XM_005252021.1:c.495G>T, XM_005252022.1:c.477G>T, XM_005252023.1:c.477G>T, XM_005252024.1:c.477G>T, XM_005252024.2:c.477G>T, XM_005252025.1:c.477G>T, XM_005252026.1:c.462G>T, XM_005252026.3:c.462G>T, XM_005252027.1:c.462G>T, XM_005252027.2:c.462G>T, XM_005252028.1:c.348G>T, XM_005252029.1:c.477G>T, XM_005252030.1:c.-1879G>T, XM_006717126.2:c.534G>T, XM_011518722.1:c.783G>T, XM_011518723.1:c.726G>T, XM_011518724.1:c.651G>T, XM_011518725.1:c.651G>T, XM_011518726.1:c.651G>T, XM_011518727.1:c.651G>T, XM_011518728.1:c.651G>T, XM_011518729.1:c.651G>T, XM_011518730.1:c.783G>T, XM_011518731.1:c.612G>T, XM_011518732.1:c.594G>T, XM_011518733.1:c.555G>T, XM_011518734.1:c.540G>T, XM_011518735.1:c.534G>T, XM_011518736.1:c.519G>T, XM_011518737.1:c.477G>T, XM_011518738.1:c.438G>T, XM_011518739.1:c.408G>T, XM_011518740.1:c.408G>T, XM_011518741.1:c.363G>T, XM_011518742.1:c.306G>T, XM_011518743.1:c.291G>T, XM_011518744.1:c.609G>T, XP_005252067.1:p.Val222, XP_005252068.1:p.Val203, XP_005252069.1:p.Val178, XP_005252070.1:p.Val178, XP_005252071.1:p.Val178, XP_005252072.1:p.Val178, XP_005252073.1:p.Val178, XP_005252074.1:p.Val173, XP_005252075.1:p.Val173, XP_005252076.1:p.Val173, XP_005252077.1:p.Val173, XP_005252078.1:p.Val165, XP_005252079.1:p.Val159, XP_005252080.1:p.Val159, XP_005252081.1:p.Val159, XP_005252082.1:p.Val159, XP_005252083.1:p.Val154, XP_005252084.1:p.Val154, XP_005252085.1:p.Val116, XP_005252086.1:p.Val159, XP_006717189.1:p.Val178, XP_011517024.1:p.Val261, XP_011517025.1:p.Val242, XP_011517026.1:p.Val217, XP_011517027.1:p.Val217, XP_011517028.1:p.Val217, XP_011517029.1:p.Val217, XP_011517030.1:p.Val217, XP_011517031.1:p.Val217, XP_011517032.1:p.Val261, XP_011517033.1:p.Val204, XP_011517034.1:p.Val198, XP_011517035.1:p.Val185, XP_011517036.1:p.Val180, XP_011517037.1:p.Val178, XP_011517038.1:p.Val173, XP_011517039.1:p.Val159, XP_011517040.1:p.Val146, XP_011517041.1:p.Val136, XP_011517042.1:p.Val136, XP_011517043.1:p.Val121, XP_011517044.1:p.Val102, XP_011517045.1:p.Val97, XP_011517046.1:p.Val203
                      11.

                      rs780168822 [Homo sapiens]
                        CACGAACTGACCCGAGCAGGGGCCC[A/C/G]CATACCAAGATGAGCTGCACGCCCC
                        Chromosome:
                        9:128494718
                        Gene:
                        ODF2 (GeneView)
                        Functional Consequence:
                        intron variant,missense
                        Validated:
                        by cluster,by frequency
                        HGVS:
                        NC_000009.11:g.131256997G>A, NC_000009.12:g.128494718G>A, NG_029568.1:g.44564G>A, NM_001242352.1:c.1896+50G>A, NM_001242353.1:c.1911+50G>A, NM_001242354.1:c.1718G>A, NM_002540.4:c.1839+50G>A, NM_153432.1:c.2093G>A, NM_153433.1:c.1911+50G>A, NM_153435.1:c.2103+50G>A, NM_153436.1:c.1961G>A, NM_153437.2:c.1904G>A, NM_153439.1:c.1949G>A, NM_153440.1:c.1904G>A, NP_001229283.1:p.Arg573His, NP_702910.1:p.Arg698His, NP_702914.1:p.Arg654His, NP_702915.1:p.Arg635His, NP_702917.1:p.Arg650His, NP_702918.1:p.Arg635His, XM_005252010.1:c.2043+50G>A, XM_005252011.1:c.1986+50G>A, XM_005252012.1:c.1911+50G>A, XM_005252012.2:c.1911+50G>A, XM_005252013.1:c.1911+50G>A, XM_005252013.2:c.1911+50G>A, XM_005252014.1:c.1911+50G>A, XM_005252014.2:c.1911+50G>A, XM_005252015.1:c.1911+50G>A, XM_005252016.1:c.1911+50G>A, XM_005252016.2:c.1911+50G>A, XM_005252017.1:c.1896+50G>A, XM_005252017.3:c.1896+50G>A, XM_005252018.1:c.1896+50G>A, XM_005252019.1:c.1896+50G>A, XM_005252019.2:c.1896+50G>A, XM_005252020.1:c.1896+50G>A, XM_005252020.2:c.1896+50G>A, XM_005252021.1:c.1872+50G>A, XM_005252022.1:c.1854+50G>A, XM_005252023.1:c.1854+50G>A, XM_005252024.1:c.1854+50G>A, XM_005252024.2:c.1854+50G>A, XM_005252025.1:c.1854+50G>A, XM_005252026.1:c.1839+50G>A, XM_005252026.3:c.1839+50G>A, XM_005252027.1:c.1839+50G>A, XM_005252027.2:c.1839+50G>A, XM_005252028.1:c.1725+50G>A, XM_005252029.1:c.1854+50G>A, XM_005252030.1:c.1191+50G>A, XM_006717126.2:c.1911+50G>A, XM_011518722.1:c.2160+50G>A, XM_011518723.1:c.2103+50G>A, XM_011518724.1:c.2028+50G>A, XM_011518725.1:c.2028+50G>A, XM_011518726.1:c.2028+50G>A, XM_011518727.1:c.2028+50G>A, XM_011518728.1:c.2028+50G>A, XM_011518729.1:c.2028+50G>A, XM_011518730.1:c.2160+50G>A, XM_011518731.1:c.1989+50G>A, XM_011518732.1:c.1971+50G>A, XM_011518733.1:c.1932+50G>A, XM_011518734.1:c.1917+50G>A, XM_011518735.1:c.1911+50G>A, XM_011518736.1:c.1896+50G>A, XM_011518737.1:c.1854+50G>A, XM_011518738.1:c.1815+50G>A, XM_011518739.1:c.1785+50G>A, XM_011518740.1:c.1785+50G>A, XM_011518741.1:c.1740+50G>A, XM_011518742.1:c.1683+50G>A, XM_011518743.1:c.1668+50G>A, XM_011518744.1:c.2036G>A, XP_011517046.1:p.Arg679His
                        12.

                        rs780074465 [Homo sapiens]
                          CGAAGCTGGCTGAGTGCCAAGACCA[A/G]CTGCAGGGCTATGAGCGGAAGAACA
                          Chromosome:
                          9:128494605
                          Gene:
                          ODF2 (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          no info
                          HGVS:
                          NC_000009.11:g.131256884A>G, NC_000009.12:g.128494605A>G, NG_029568.1:g.44451A>G, NM_001242352.1:c.1833A>G, NM_001242353.1:c.1848A>G, NM_001242354.1:c.1605A>G, NM_002540.4:c.1776A>G, NM_153432.1:c.1980A>G, NM_153433.1:c.1848A>G, NM_153435.1:c.2040A>G, NM_153436.1:c.1848A>G, NM_153437.2:c.1791A>G, NM_153439.1:c.1836A>G, NM_153440.1:c.1791A>G, NP_001229281.1:p.Gln611, NP_001229282.1:p.Gln616, NP_001229283.1:p.Gln535, NP_002531.3:p.Gln592, NP_702910.1:p.Gln660, NP_702911.1:p.Gln616, NP_702913.1:p.Gln680, NP_702914.1:p.Gln616, NP_702915.1:p.Gln597, NP_702917.1:p.Gln612, NP_702918.1:p.Gln597, XM_005252010.1:c.1980A>G, XM_005252011.1:c.1923A>G, XM_005252012.1:c.1848A>G, XM_005252012.2:c.1848A>G, XM_005252013.1:c.1848A>G, XM_005252013.2:c.1848A>G, XM_005252014.1:c.1848A>G, XM_005252014.2:c.1848A>G, XM_005252015.1:c.1848A>G, XM_005252016.1:c.1848A>G, XM_005252016.2:c.1848A>G, XM_005252017.1:c.1833A>G, XM_005252017.3:c.1833A>G, XM_005252018.1:c.1833A>G, XM_005252019.1:c.1833A>G, XM_005252019.2:c.1833A>G, XM_005252020.1:c.1833A>G, XM_005252020.2:c.1833A>G, XM_005252021.1:c.1809A>G, XM_005252022.1:c.1791A>G, XM_005252023.1:c.1791A>G, XM_005252024.1:c.1791A>G, XM_005252024.2:c.1791A>G, XM_005252025.1:c.1791A>G, XM_005252026.1:c.1776A>G, XM_005252026.3:c.1776A>G, XM_005252027.1:c.1776A>G, XM_005252027.2:c.1776A>G, XM_005252028.1:c.1662A>G, XM_005252029.1:c.1791A>G, XM_005252030.1:c.1128A>G, XM_006717126.2:c.1848A>G, XM_011518722.1:c.2097A>G, XM_011518723.1:c.2040A>G, XM_011518724.1:c.1965A>G, XM_011518725.1:c.1965A>G, XM_011518726.1:c.1965A>G, XM_011518727.1:c.1965A>G, XM_011518728.1:c.1965A>G, XM_011518729.1:c.1965A>G, XM_011518730.1:c.2097A>G, XM_011518731.1:c.1926A>G, XM_011518732.1:c.1908A>G, XM_011518733.1:c.1869A>G, XM_011518734.1:c.1854A>G, XM_011518735.1:c.1848A>G, XM_011518736.1:c.1833A>G, XM_011518737.1:c.1791A>G, XM_011518738.1:c.1752A>G, XM_011518739.1:c.1722A>G, XM_011518740.1:c.1722A>G, XM_011518741.1:c.1677A>G, XM_011518742.1:c.1620A>G, XM_011518743.1:c.1605A>G, XM_011518744.1:c.1923A>G, XP_005252067.1:p.Gln660, XP_005252068.1:p.Gln641, XP_005252069.1:p.Gln616, XP_005252070.1:p.Gln616, XP_005252071.1:p.Gln616, XP_005252072.1:p.Gln616, XP_005252073.1:p.Gln616, XP_005252074.1:p.Gln611, XP_005252075.1:p.Gln611, XP_005252076.1:p.Gln611, XP_005252077.1:p.Gln611, XP_005252078.1:p.Gln603, XP_005252079.1:p.Gln597, XP_005252080.1:p.Gln597, XP_005252081.1:p.Gln597, XP_005252082.1:p.Gln597, XP_005252083.1:p.Gln592, XP_005252084.1:p.Gln592, XP_005252085.1:p.Gln554, XP_005252086.1:p.Gln597, XP_005252087.1:p.Gln376, XP_006717189.1:p.Gln616, XP_011517024.1:p.Gln699, XP_011517025.1:p.Gln680, XP_011517026.1:p.Gln655, XP_011517027.1:p.Gln655, XP_011517028.1:p.Gln655, XP_011517029.1:p.Gln655, XP_011517030.1:p.Gln655, XP_011517031.1:p.Gln655, XP_011517032.1:p.Gln699, XP_011517033.1:p.Gln642, XP_011517034.1:p.Gln636, XP_011517035.1:p.Gln623, XP_011517036.1:p.Gln618, XP_011517037.1:p.Gln616, XP_011517038.1:p.Gln611, XP_011517039.1:p.Gln597, XP_011517040.1:p.Gln584, XP_011517041.1:p.Gln574, XP_011517042.1:p.Gln574, XP_011517043.1:p.Gln559, XP_011517044.1:p.Gln540, XP_011517045.1:p.Gln535, XP_011517046.1:p.Gln641
                          13.

                          rs780073938 [Homo sapiens]
                            GAAGGATTCTGAAAGACTAATGGAG[A/C]AACAAGGAGCACTGCTGAAACGGCT
                            Chromosome:
                            9:128481601
                            Gene:
                            ODF2 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            by frequency
                            HGVS:
                            NC_000009.11:g.131243880C>A, NC_000009.12:g.128481601C>A, NG_029568.1:g.31447C>A, NM_001242352.1:c.850C>A, NM_001242353.1:c.865C>A, NM_001242354.1:c.622C>A, NM_002540.4:c.793C>A, NM_153432.1:c.997C>A, NM_153433.1:c.865C>A, NM_153435.1:c.1057C>A, NM_153436.1:c.865C>A, NM_153437.2:c.808C>A, NM_153439.1:c.940C>A, NM_153440.1:c.808C>A, NP_001229281.1:p.Gln284Lys, NP_001229282.1:p.Gln289Lys, NP_001229283.1:p.Gln208Lys, NP_002531.3:p.Gln265Lys, NP_702910.1:p.Gln333Lys, NP_702911.1:p.Gln289Lys, NP_702913.1:p.Gln353Lys, NP_702914.1:p.Gln289Lys, NP_702915.1:p.Gln270Lys, NP_702917.1:p.Gln314Lys, NP_702918.1:p.Gln270Lys, XM_005252010.1:c.997C>A, XM_005252011.1:c.940C>A, XM_005252012.1:c.865C>A, XM_005252012.2:c.865C>A, XM_005252013.1:c.865C>A, XM_005252013.2:c.865C>A, XM_005252014.1:c.865C>A, XM_005252014.2:c.865C>A, XM_005252015.1:c.865C>A, XM_005252016.1:c.865C>A, XM_005252016.2:c.865C>A, XM_005252017.1:c.850C>A, XM_005252017.3:c.850C>A, XM_005252018.1:c.850C>A, XM_005252019.1:c.850C>A, XM_005252019.2:c.850C>A, XM_005252020.1:c.850C>A, XM_005252020.2:c.850C>A, XM_005252021.1:c.826C>A, XM_005252022.1:c.808C>A, XM_005252023.1:c.808C>A, XM_005252024.1:c.808C>A, XM_005252024.2:c.808C>A, XM_005252025.1:c.808C>A, XM_005252026.1:c.793C>A, XM_005252026.3:c.793C>A, XM_005252027.1:c.793C>A, XM_005252027.2:c.793C>A, XM_005252028.1:c.679C>A, XM_005252029.1:c.808C>A, XM_005252030.1:c.145C>A, XM_006717126.2:c.865C>A, XM_011518722.1:c.1114C>A, XM_011518723.1:c.1057C>A, XM_011518724.1:c.982C>A, XM_011518725.1:c.982C>A, XM_011518726.1:c.982C>A, XM_011518727.1:c.982C>A, XM_011518728.1:c.982C>A, XM_011518729.1:c.982C>A, XM_011518730.1:c.1114C>A, XM_011518731.1:c.943C>A, XM_011518732.1:c.925C>A, XM_011518733.1:c.886C>A, XM_011518734.1:c.871C>A, XM_011518735.1:c.865C>A, XM_011518736.1:c.850C>A, XM_011518737.1:c.808C>A, XM_011518738.1:c.769C>A, XM_011518739.1:c.739C>A, XM_011518740.1:c.739C>A, XM_011518741.1:c.694C>A, XM_011518742.1:c.637C>A, XM_011518743.1:c.622C>A, XM_011518744.1:c.940C>A, XP_005252067.1:p.Gln333Lys, XP_005252068.1:p.Gln314Lys, XP_005252069.1:p.Gln289Lys, XP_005252070.1:p.Gln289Lys, XP_005252071.1:p.Gln289Lys, XP_005252072.1:p.Gln289Lys, XP_005252073.1:p.Gln289Lys, XP_005252074.1:p.Gln284Lys, XP_005252075.1:p.Gln284Lys, XP_005252076.1:p.Gln284Lys, XP_005252077.1:p.Gln284Lys, XP_005252078.1:p.Gln276Lys, XP_005252079.1:p.Gln270Lys, XP_005252080.1:p.Gln270Lys, XP_005252081.1:p.Gln270Lys, XP_005252082.1:p.Gln270Lys, XP_005252083.1:p.Gln265Lys, XP_005252084.1:p.Gln265Lys, XP_005252085.1:p.Gln227Lys, XP_005252086.1:p.Gln270Lys, XP_005252087.1:p.Gln49Lys, XP_006717189.1:p.Gln289Lys, XP_011517024.1:p.Gln372Lys, XP_011517025.1:p.Gln353Lys, XP_011517026.1:p.Gln328Lys, XP_011517027.1:p.Gln328Lys, XP_011517028.1:p.Gln328Lys, XP_011517029.1:p.Gln328Lys, XP_011517030.1:p.Gln328Lys, XP_011517031.1:p.Gln328Lys, XP_011517032.1:p.Gln372Lys, XP_011517033.1:p.Gln315Lys, XP_011517034.1:p.Gln309Lys, XP_011517035.1:p.Gln296Lys, XP_011517036.1:p.Gln291Lys, XP_011517037.1:p.Gln289Lys, XP_011517038.1:p.Gln284Lys, XP_011517039.1:p.Gln270Lys, XP_011517040.1:p.Gln257Lys, XP_011517041.1:p.Gln247Lys, XP_011517042.1:p.Gln247Lys, XP_011517043.1:p.Gln232Lys, XP_011517044.1:p.Gln213Lys, XP_011517045.1:p.Gln208Lys, XP_011517046.1:p.Gln314Lys
                            14.

                            rs779962939 [Homo sapiens]
                              GAAAGGGGACACTGTGAATGTGCGG[C/T]GGAGTGTCCGGGTGAAAACCAAGGT
                              Chromosome:
                              9:128460987
                              Gene:
                              ODF2 (GeneView)
                              Functional Consequence:
                              intron variant,missense
                              Validated:
                              no info
                              HGVS:
                              NC_000009.11:g.131223266C>T, NC_000009.12:g.128460987C>T, NG_029568.1:g.10833C>T, NM_001242352.1:c.154C>T, NM_001242353.1:c.169C>T, NM_001242354.1:c.154C>T, NM_002540.4:c.154C>T, NM_153432.1:c.301C>T, NM_153433.1:c.169C>T, NM_153435.1:c.418C>T, NM_153436.1:c.169C>T, NM_153437.2:c.169C>T, NM_153439.1:c.301C>T, NM_153440.1:c.169C>T, NP_001229281.1:p.Arg52Trp, NP_001229282.1:p.Arg57Trp, NP_001229283.1:p.Arg52Trp, NP_002531.3:p.Arg52Trp, NP_702910.1:p.Arg101Trp, NP_702911.1:p.Arg57Trp, NP_702913.1:p.Arg140Trp, NP_702914.1:p.Arg57Trp, NP_702915.1:p.Arg57Trp, NP_702917.1:p.Arg101Trp, NP_702918.1:p.Arg57Trp, XM_005252010.1:c.301C>T, XM_005252011.1:c.301C>T, XM_005252012.1:c.169C>T, XM_005252012.2:c.169C>T, XM_005252013.1:c.169C>T, XM_005252013.2:c.169C>T, XM_005252014.1:c.169C>T, XM_005252014.2:c.169C>T, XM_005252015.1:c.169C>T, XM_005252016.1:c.169C>T, XM_005252016.2:c.169C>T, XM_005252017.1:c.154C>T, XM_005252017.3:c.154C>T, XM_005252018.1:c.154C>T, XM_005252019.1:c.154C>T, XM_005252019.2:c.154C>T, XM_005252020.1:c.154C>T, XM_005252020.2:c.154C>T, XM_005252021.1:c.301C>T, XM_005252022.1:c.169C>T, XM_005252023.1:c.169C>T, XM_005252024.1:c.169C>T, XM_005252024.2:c.169C>T, XM_005252025.1:c.169C>T, XM_005252026.1:c.154C>T, XM_005252026.3:c.154C>T, XM_005252027.1:c.154C>T, XM_005252027.2:c.154C>T, XM_005252028.1:c.154C>T, XM_005252029.1:c.169C>T, XM_006717126.2:c.169C>T, XM_011518722.1:c.418C>T, XM_011518723.1:c.418C>T, XM_011518724.1:c.286C>T, XM_011518725.1:c.286C>T, XM_011518726.1:c.286C>T, XM_011518727.1:c.286C>T, XM_011518728.1:c.286C>T, XM_011518729.1:c.286C>T, XM_011518730.1:c.418C>T, XM_011518731.1:c.418C>T, XM_011518732.1:c.286C>T, XM_011518733.1:c.418C>T, XM_011518734.1:c.255+1330C>T, XM_011518735.1:c.169C>T, XM_011518736.1:c.154C>T, XM_011518737.1:c.169C>T, XM_011518738.1:c.301C>T, XM_011518739.1:c.123+1330C>T, XM_011518740.1:c.123+1330C>T, XM_011518741.1:c.169C>T, XM_011518742.1:c.169C>T, XM_011518743.1:c.154C>T, XM_011518744.1:c.301C>T, XP_005252067.1:p.Arg101Trp, XP_005252068.1:p.Arg101Trp, XP_005252069.1:p.Arg57Trp, XP_005252070.1:p.Arg57Trp, XP_005252071.1:p.Arg57Trp, XP_005252072.1:p.Arg57Trp, XP_005252073.1:p.Arg57Trp, XP_005252074.1:p.Arg52Trp, XP_005252075.1:p.Arg52Trp, XP_005252076.1:p.Arg52Trp, XP_005252077.1:p.Arg52Trp, XP_005252078.1:p.Arg101Trp, XP_005252079.1:p.Arg57Trp, XP_005252080.1:p.Arg57Trp, XP_005252081.1:p.Arg57Trp, XP_005252082.1:p.Arg57Trp, XP_005252083.1:p.Arg52Trp, XP_005252084.1:p.Arg52Trp, XP_005252085.1:p.Arg52Trp, XP_005252086.1:p.Arg57Trp, XP_006717189.1:p.Arg57Trp, XP_011517024.1:p.Arg140Trp, XP_011517025.1:p.Arg140Trp, XP_011517026.1:p.Arg96Trp, XP_011517027.1:p.Arg96Trp, XP_011517028.1:p.Arg96Trp, XP_011517029.1:p.Arg96Trp, XP_011517030.1:p.Arg96Trp, XP_011517031.1:p.Arg96Trp, XP_011517032.1:p.Arg140Trp, XP_011517033.1:p.Arg140Trp, XP_011517034.1:p.Arg96Trp, XP_011517035.1:p.Arg140Trp, XP_011517037.1:p.Arg57Trp, XP_011517038.1:p.Arg52Trp, XP_011517039.1:p.Arg57Trp, XP_011517040.1:p.Arg101Trp, XP_011517043.1:p.Arg57Trp, XP_011517044.1:p.Arg57Trp, XP_011517045.1:p.Arg52Trp, XP_011517046.1:p.Arg101Trp
                              15.

                              rs779884499 [Homo sapiens]
                                CACCTTGTGGCGCACCCAGTGTAAC[-/TG]TGACGGTAGGTGATGCACTCACGTA
                                Chromosome:
                                9:128459651
                                Gene:
                                ODF2 (GeneView)
                                Functional Consequence:
                                frameshift variant,upstream variant 2KB,utr variant 5 prime
                                Validated:
                                by cluster
                                HGVS:
                                NC_000009.11:g.131221930_131221931delTG, NC_000009.12:g.128459651_128459652delTG, NG_029568.1:g.9497_9498delTG, NM_001242352.1:c.-53_-52delTG, NM_001242353.1:c.117_118delTG, NM_001242354.1:c.-53_-52delTG, NM_002540.4:c.-158_-157delTG, NM_153432.1:c.249_250delTG, NM_153433.1:c.117_118delTG, NM_153435.1:c.249_250delTG, NM_153436.1:c.117_118delTG, NM_153437.2:c.117_118delTG, NM_153439.1:c.249_250delTG, NM_153440.1:c.117_118delTG, NP_001229282.1:p.Val40Aspfs, NP_702910.1:p.Val84Aspfs, NP_702911.1:p.Val40Aspfs, NP_702913.1:p.Val84Aspfs, NP_702914.1:p.Val40Aspfs, NP_702915.1:p.Val40Aspfs, NP_702917.1:p.Val84Aspfs, NP_702918.1:p.Val40Aspfs, XM_005252010.1:c.249_250delTG, XM_005252011.1:c.249_250delTG, XM_005252012.1:c.117_118delTG, XM_005252012.2:c.117_118delTG, XM_005252013.1:c.117_118delTG, XM_005252013.2:c.117_118delTG, XM_005252014.1:c.117_118delTG, XM_005252014.2:c.117_118delTG, XM_005252015.1:c.117_118delTG, XM_005252016.1:c.117_118delTG, XM_005252016.2:c.117_118delTG, XM_005252017.1:c.-53_-52delTG, XM_005252017.3:c.-53_-52delTG, XM_005252018.1:c.-53_-52delTG, XM_005252019.1:c.-53_-52delTG, XM_005252019.2:c.-53_-52delTG, XM_005252020.1:c.-53_-52delTG, XM_005252020.2:c.-53_-52delTG, XM_005252021.1:c.249_250delTG, XM_005252022.1:c.117_118delTG, XM_005252023.1:c.117_118delTG, XM_005252024.1:c.117_118delTG, XM_005252024.2:c.117_118delTG, XM_005252025.1:c.117_118delTG, XM_005252026.1:c.-53_-52delTG, XM_005252026.3:c.-53_-52delTG, XM_005252027.1:c.-53_-52delTG, XM_005252027.2:c.-53_-52delTG, XM_005252028.1:c.-53_-52delTG, XM_005252029.1:c.117_118delTG, XM_006717126.2:c.117_118delTG, XM_011518722.1:c.249_250delTG, XM_011518723.1:c.249_250delTG, XM_011518724.1:c.117_118delTG, XM_011518725.1:c.117_118delTG, XM_011518726.1:c.117_118delTG, XM_011518727.1:c.117_118delTG, XM_011518728.1:c.117_118delTG, XM_011518729.1:c.117_118delTG, XM_011518730.1:c.249_250delTG, XM_011518731.1:c.249_250delTG, XM_011518732.1:c.117_118delTG, XM_011518733.1:c.249_250delTG, XM_011518734.1:c.249_250delTG, XM_011518735.1:c.117_118delTG, XM_011518736.1:c.-695_-694delTG, XM_011518737.1:c.117_118delTG, XM_011518738.1:c.249_250delTG, XM_011518739.1:c.117_118delTG, XM_011518740.1:c.117_118delTG, XM_011518741.1:c.117_118delTG, XM_011518742.1:c.117_118delTG, XM_011518743.1:c.-53_-52delTG, XM_011518744.1:c.249_250delTG, XP_005252067.1:p.Val84Aspfs, XP_005252068.1:p.Val84Aspfs, XP_005252069.1:p.Val40Aspfs, XP_005252070.1:p.Val40Aspfs, XP_005252071.1:p.Val40Aspfs, XP_005252072.1:p.Val40Aspfs, XP_005252073.1:p.Val40Aspfs, XP_005252078.1:p.Val84Aspfs, XP_005252079.1:p.Val40Aspfs, XP_005252080.1:p.Val40Aspfs, XP_005252081.1:p.Val40Aspfs, XP_005252082.1:p.Val40Aspfs, XP_005252086.1:p.Val40Aspfs, XP_006717189.1:p.Val40Aspfs, XP_011517024.1:p.Val84Aspfs, XP_011517025.1:p.Val84Aspfs, XP_011517026.1:p.Val40Aspfs, XP_011517027.1:p.Val40Aspfs, XP_011517028.1:p.Val40Aspfs, XP_011517029.1:p.Val40Aspfs, XP_011517030.1:p.Val40Aspfs, XP_011517031.1:p.Val40Aspfs, XP_011517032.1:p.Val84Aspfs, XP_011517033.1:p.Val84Aspfs, XP_011517034.1:p.Val40Aspfs, XP_011517035.1:p.Val84Aspfs, XP_011517036.1:p.Val84Aspfs, XP_011517037.1:p.Val40Aspfs, XP_011517039.1:p.Val40Aspfs, XP_011517040.1:p.Val84Aspfs, XP_011517041.1:p.Val40Aspfs, XP_011517042.1:p.Val40Aspfs, XP_011517043.1:p.Val40Aspfs, XP_011517044.1:p.Val40Aspfs, XP_011517046.1:p.Val84Aspfs
                                16.

                                rs779766045 [Homo sapiens]
                                  GGAAATGGATGGGGCTGCGGCTGCC[A/G]AGCAGGTCATGGCCTTGAAGGATAC
                                  Chromosome:
                                  9:128472998
                                  Gene:
                                  ODF2 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000009.11:g.131235277A>G, NC_000009.12:g.128472998A>G, NG_029568.1:g.22844A>G, NM_001242352.1:c.652A>G, NM_001242353.1:c.667A>G, NM_001242354.1:c.424A>G, NM_002540.4:c.595A>G, NM_153432.1:c.799A>G, NM_153433.1:c.667A>G, NM_153435.1:c.859A>G, NM_153436.1:c.667A>G, NM_153437.2:c.610A>G, NM_153439.1:c.742A>G, NM_153440.1:c.610A>G, NP_001229281.1:p.Lys218Glu, NP_001229282.1:p.Lys223Glu, NP_001229283.1:p.Lys142Glu, NP_002531.3:p.Lys199Glu, NP_702910.1:p.Lys267Glu, NP_702911.1:p.Lys223Glu, NP_702913.1:p.Lys287Glu, NP_702914.1:p.Lys223Glu, NP_702915.1:p.Lys204Glu, NP_702917.1:p.Lys248Glu, NP_702918.1:p.Lys204Glu, XM_005252010.1:c.799A>G, XM_005252011.1:c.742A>G, XM_005252012.1:c.667A>G, XM_005252012.2:c.667A>G, XM_005252013.1:c.667A>G, XM_005252013.2:c.667A>G, XM_005252014.1:c.667A>G, XM_005252014.2:c.667A>G, XM_005252015.1:c.667A>G, XM_005252016.1:c.667A>G, XM_005252016.2:c.667A>G, XM_005252017.1:c.652A>G, XM_005252017.3:c.652A>G, XM_005252018.1:c.652A>G, XM_005252019.1:c.652A>G, XM_005252019.2:c.652A>G, XM_005252020.1:c.652A>G, XM_005252020.2:c.652A>G, XM_005252021.1:c.628A>G, XM_005252022.1:c.610A>G, XM_005252023.1:c.610A>G, XM_005252024.1:c.610A>G, XM_005252024.2:c.610A>G, XM_005252025.1:c.610A>G, XM_005252026.1:c.595A>G, XM_005252026.3:c.595A>G, XM_005252027.1:c.595A>G, XM_005252027.2:c.595A>G, XM_005252028.1:c.481A>G, XM_005252029.1:c.610A>G, XM_005252030.1:c.-302A>G, XM_006717126.2:c.667A>G, XM_011518722.1:c.916A>G, XM_011518723.1:c.859A>G, XM_011518724.1:c.784A>G, XM_011518725.1:c.784A>G, XM_011518726.1:c.784A>G, XM_011518727.1:c.784A>G, XM_011518728.1:c.784A>G, XM_011518729.1:c.784A>G, XM_011518730.1:c.916A>G, XM_011518731.1:c.745A>G, XM_011518732.1:c.727A>G, XM_011518733.1:c.688A>G, XM_011518734.1:c.673A>G, XM_011518735.1:c.667A>G, XM_011518736.1:c.652A>G, XM_011518737.1:c.610A>G, XM_011518738.1:c.571A>G, XM_011518739.1:c.541A>G, XM_011518740.1:c.541A>G, XM_011518741.1:c.496A>G, XM_011518742.1:c.439A>G, XM_011518743.1:c.424A>G, XM_011518744.1:c.742A>G, XP_005252067.1:p.Lys267Glu, XP_005252068.1:p.Lys248Glu, XP_005252069.1:p.Lys223Glu, XP_005252070.1:p.Lys223Glu, XP_005252071.1:p.Lys223Glu, XP_005252072.1:p.Lys223Glu, XP_005252073.1:p.Lys223Glu, XP_005252074.1:p.Lys218Glu, XP_005252075.1:p.Lys218Glu, XP_005252076.1:p.Lys218Glu, XP_005252077.1:p.Lys218Glu, XP_005252078.1:p.Lys210Glu, XP_005252079.1:p.Lys204Glu, XP_005252080.1:p.Lys204Glu, XP_005252081.1:p.Lys204Glu, XP_005252082.1:p.Lys204Glu, XP_005252083.1:p.Lys199Glu, XP_005252084.1:p.Lys199Glu, XP_005252085.1:p.Lys161Glu, XP_005252086.1:p.Lys204Glu, XP_006717189.1:p.Lys223Glu, XP_011517024.1:p.Lys306Glu, XP_011517025.1:p.Lys287Glu, XP_011517026.1:p.Lys262Glu, XP_011517027.1:p.Lys262Glu, XP_011517028.1:p.Lys262Glu, XP_011517029.1:p.Lys262Glu, XP_011517030.1:p.Lys262Glu, XP_011517031.1:p.Lys262Glu, XP_011517032.1:p.Lys306Glu, XP_011517033.1:p.Lys249Glu, XP_011517034.1:p.Lys243Glu, XP_011517035.1:p.Lys230Glu, XP_011517036.1:p.Lys225Glu, XP_011517037.1:p.Lys223Glu, XP_011517038.1:p.Lys218Glu, XP_011517039.1:p.Lys204Glu, XP_011517040.1:p.Lys191Glu, XP_011517041.1:p.Lys181Glu, XP_011517042.1:p.Lys181Glu, XP_011517043.1:p.Lys166Glu, XP_011517044.1:p.Lys147Glu, XP_011517045.1:p.Lys142Glu, XP_011517046.1:p.Lys248Glu
                                  17.

                                  rs779686961 [Homo sapiens]
                                    GAGCCGAGAAGAGCGAGGAGTATGC[C/T]GAGCAGCTACACGTGCAACTCGCTG
                                    Chromosome:
                                    9:128484856
                                    Gene:
                                    ODF2 (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000009.11:g.131247135T>C, NC_000009.12:g.128484856T>C, NG_029568.1:g.34702T>C, NM_001242352.1:c.1245T>C, NM_001242353.1:c.1260T>C, NM_001242354.1:c.1017T>C, NM_002540.4:c.1188T>C, NM_153432.1:c.1392T>C, NM_153433.1:c.1260T>C, NM_153435.1:c.1452T>C, NM_153436.1:c.1260T>C, NM_153437.2:c.1203T>C, NM_153439.1:c.1335T>C, NM_153440.1:c.1203T>C, NP_001229281.1:p.Ala415, NP_001229282.1:p.Ala420, NP_001229283.1:p.Ala339, NP_002531.3:p.Ala396, NP_702910.1:p.Ala464, NP_702911.1:p.Ala420, NP_702913.1:p.Ala484, NP_702914.1:p.Ala420, NP_702915.1:p.Ala401, NP_702917.1:p.Ala445, NP_702918.1:p.Ala401, XM_005252010.1:c.1392T>C, XM_005252011.1:c.1335T>C, XM_005252012.1:c.1260T>C, XM_005252012.2:c.1260T>C, XM_005252013.1:c.1260T>C, XM_005252013.2:c.1260T>C, XM_005252014.1:c.1260T>C, XM_005252014.2:c.1260T>C, XM_005252015.1:c.1260T>C, XM_005252016.1:c.1260T>C, XM_005252016.2:c.1260T>C, XM_005252017.1:c.1245T>C, XM_005252017.3:c.1245T>C, XM_005252018.1:c.1245T>C, XM_005252019.1:c.1245T>C, XM_005252019.2:c.1245T>C, XM_005252020.1:c.1245T>C, XM_005252020.2:c.1245T>C, XM_005252021.1:c.1221T>C, XM_005252022.1:c.1203T>C, XM_005252023.1:c.1203T>C, XM_005252024.1:c.1203T>C, XM_005252024.2:c.1203T>C, XM_005252025.1:c.1203T>C, XM_005252026.1:c.1188T>C, XM_005252026.3:c.1188T>C, XM_005252027.1:c.1188T>C, XM_005252027.2:c.1188T>C, XM_005252028.1:c.1074T>C, XM_005252029.1:c.1203T>C, XM_005252030.1:c.540T>C, XM_006717126.2:c.1260T>C, XM_011518722.1:c.1509T>C, XM_011518723.1:c.1452T>C, XM_011518724.1:c.1377T>C, XM_011518725.1:c.1377T>C, XM_011518726.1:c.1377T>C, XM_011518727.1:c.1377T>C, XM_011518728.1:c.1377T>C, XM_011518729.1:c.1377T>C, XM_011518730.1:c.1509T>C, XM_011518731.1:c.1338T>C, XM_011518732.1:c.1320T>C, XM_011518733.1:c.1281T>C, XM_011518734.1:c.1266T>C, XM_011518735.1:c.1260T>C, XM_011518736.1:c.1245T>C, XM_011518737.1:c.1203T>C, XM_011518738.1:c.1164T>C, XM_011518739.1:c.1134T>C, XM_011518740.1:c.1134T>C, XM_011518741.1:c.1089T>C, XM_011518742.1:c.1032T>C, XM_011518743.1:c.1017T>C, XM_011518744.1:c.1335T>C, XP_005252067.1:p.Ala464, XP_005252068.1:p.Ala445, XP_005252069.1:p.Ala420, XP_005252070.1:p.Ala420, XP_005252071.1:p.Ala420, XP_005252072.1:p.Ala420, XP_005252073.1:p.Ala420, XP_005252074.1:p.Ala415, XP_005252075.1:p.Ala415, XP_005252076.1:p.Ala415, XP_005252077.1:p.Ala415, XP_005252078.1:p.Ala407, XP_005252079.1:p.Ala401, XP_005252080.1:p.Ala401, XP_005252081.1:p.Ala401, XP_005252082.1:p.Ala401, XP_005252083.1:p.Ala396, XP_005252084.1:p.Ala396, XP_005252085.1:p.Ala358, XP_005252086.1:p.Ala401, XP_005252087.1:p.Ala180, XP_006717189.1:p.Ala420, XP_011517024.1:p.Ala503, XP_011517025.1:p.Ala484, XP_011517026.1:p.Ala459, XP_011517027.1:p.Ala459, XP_011517028.1:p.Ala459, XP_011517029.1:p.Ala459, XP_011517030.1:p.Ala459, XP_011517031.1:p.Ala459, XP_011517032.1:p.Ala503, XP_011517033.1:p.Ala446, XP_011517034.1:p.Ala440, XP_011517035.1:p.Ala427, XP_011517036.1:p.Ala422, XP_011517037.1:p.Ala420, XP_011517038.1:p.Ala415, XP_011517039.1:p.Ala401, XP_011517040.1:p.Ala388, XP_011517041.1:p.Ala378, XP_011517042.1:p.Ala378, XP_011517043.1:p.Ala363, XP_011517044.1:p.Ala344, XP_011517045.1:p.Ala339, XP_011517046.1:p.Ala445
                                    18.

                                    rs779322170 [Homo sapiens]
                                      CTGCTTTCACTTTGTGATCTTCCAG[A/C]CGGGTAACAGATCTTGTAAACCAAC
                                      Chromosome:
                                      9:128487890
                                      Gene:
                                      ODF2 (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      by frequency
                                      HGVS:
                                      NC_000009.11:g.131250169C>A, NC_000009.12:g.128487890C>A, NG_029568.1:g.37736C>A, NM_001242352.1:c.1386C>A, NM_001242353.1:c.1401C>A, NM_001242354.1:c.1158C>A, NM_002540.4:c.1329C>A, NM_153432.1:c.1533C>A, NM_153433.1:c.1401C>A, NM_153435.1:c.1593C>A, NM_153436.1:c.1401C>A, NM_153437.2:c.1344C>A, NM_153439.1:c.1476C>A, NM_153440.1:c.1344C>A, NP_001229281.1:p.Asp462Glu, NP_001229282.1:p.Asp467Glu, NP_001229283.1:p.Asp386Glu, NP_002531.3:p.Asp443Glu, NP_702910.1:p.Asp511Glu, NP_702911.1:p.Asp467Glu, NP_702913.1:p.Asp531Glu, NP_702914.1:p.Asp467Glu, NP_702915.1:p.Asp448Glu, NP_702917.1:p.Asp492Glu, NP_702918.1:p.Asp448Glu, XM_005252010.1:c.1533C>A, XM_005252011.1:c.1476C>A, XM_005252012.1:c.1401C>A, XM_005252012.2:c.1401C>A, XM_005252013.1:c.1401C>A, XM_005252013.2:c.1401C>A, XM_005252014.1:c.1401C>A, XM_005252014.2:c.1401C>A, XM_005252015.1:c.1401C>A, XM_005252016.1:c.1401C>A, XM_005252016.2:c.1401C>A, XM_005252017.1:c.1386C>A, XM_005252017.3:c.1386C>A, XM_005252018.1:c.1386C>A, XM_005252019.1:c.1386C>A, XM_005252019.2:c.1386C>A, XM_005252020.1:c.1386C>A, XM_005252020.2:c.1386C>A, XM_005252021.1:c.1362C>A, XM_005252022.1:c.1344C>A, XM_005252023.1:c.1344C>A, XM_005252024.1:c.1344C>A, XM_005252024.2:c.1344C>A, XM_005252025.1:c.1344C>A, XM_005252026.1:c.1329C>A, XM_005252026.3:c.1329C>A, XM_005252027.1:c.1329C>A, XM_005252027.2:c.1329C>A, XM_005252028.1:c.1215C>A, XM_005252029.1:c.1344C>A, XM_005252030.1:c.681C>A, XM_006717126.2:c.1401C>A, XM_011518722.1:c.1650C>A, XM_011518723.1:c.1593C>A, XM_011518724.1:c.1518C>A, XM_011518725.1:c.1518C>A, XM_011518726.1:c.1518C>A, XM_011518727.1:c.1518C>A, XM_011518728.1:c.1518C>A, XM_011518729.1:c.1518C>A, XM_011518730.1:c.1650C>A, XM_011518731.1:c.1479C>A, XM_011518732.1:c.1461C>A, XM_011518733.1:c.1422C>A, XM_011518734.1:c.1407C>A, XM_011518735.1:c.1401C>A, XM_011518736.1:c.1386C>A, XM_011518737.1:c.1344C>A, XM_011518738.1:c.1305C>A, XM_011518739.1:c.1275C>A, XM_011518740.1:c.1275C>A, XM_011518741.1:c.1230C>A, XM_011518742.1:c.1173C>A, XM_011518743.1:c.1158C>A, XM_011518744.1:c.1476C>A, XP_005252067.1:p.Asp511Glu, XP_005252068.1:p.Asp492Glu, XP_005252069.1:p.Asp467Glu, XP_005252070.1:p.Asp467Glu, XP_005252071.1:p.Asp467Glu, XP_005252072.1:p.Asp467Glu, XP_005252073.1:p.Asp467Glu, XP_005252074.1:p.Asp462Glu, XP_005252075.1:p.Asp462Glu, XP_005252076.1:p.Asp462Glu, XP_005252077.1:p.Asp462Glu, XP_005252078.1:p.Asp454Glu, XP_005252079.1:p.Asp448Glu, XP_005252080.1:p.Asp448Glu, XP_005252081.1:p.Asp448Glu, XP_005252082.1:p.Asp448Glu, XP_005252083.1:p.Asp443Glu, XP_005252084.1:p.Asp443Glu, XP_005252085.1:p.Asp405Glu, XP_005252086.1:p.Asp448Glu, XP_005252087.1:p.Asp227Glu, XP_006717189.1:p.Asp467Glu, XP_011517024.1:p.Asp550Glu, XP_011517025.1:p.Asp531Glu, XP_011517026.1:p.Asp506Glu, XP_011517027.1:p.Asp506Glu, XP_011517028.1:p.Asp506Glu, XP_011517029.1:p.Asp506Glu, XP_011517030.1:p.Asp506Glu, XP_011517031.1:p.Asp506Glu, XP_011517032.1:p.Asp550Glu, XP_011517033.1:p.Asp493Glu, XP_011517034.1:p.Asp487Glu, XP_011517035.1:p.Asp474Glu, XP_011517036.1:p.Asp469Glu, XP_011517037.1:p.Asp467Glu, XP_011517038.1:p.Asp462Glu, XP_011517039.1:p.Asp448Glu, XP_011517040.1:p.Asp435Glu, XP_011517041.1:p.Asp425Glu, XP_011517042.1:p.Asp425Glu, XP_011517043.1:p.Asp410Glu, XP_011517044.1:p.Asp391Glu, XP_011517045.1:p.Asp386Glu, XP_011517046.1:p.Asp492Glu
                                      19.

                                      rs779214229 [Homo sapiens]
                                        CTTCAGAAAAGCTGGTCTCAGTGAT[A/G]CGGTTAAGTGACCTCTCTACAGAAG
                                        Chromosome:
                                        9:128469242
                                        Gene:
                                        ODF2 (GeneView)
                                        Functional Consequence:
                                        intron variant,missense
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000009.11:g.131231521G>A, NC_000009.12:g.128469242G>A, NG_029568.1:g.19088G>A, NM_001242352.1:c.294G>A, NM_001242353.1:c.309G>A, NM_001242354.1:c.178-2066G>A, NM_002540.4:c.237G>A, NM_153432.1:c.441G>A, NM_153433.1:c.309G>A, NM_153435.1:c.501G>A, NM_153436.1:c.309G>A, NM_153437.2:c.252G>A, NM_153439.1:c.384G>A, NM_153440.1:c.252G>A, NP_001229281.1:p.Met98Ile, NP_001229282.1:p.Met103Ile, NP_002531.3:p.Met79Ile, NP_702910.1:p.Met147Ile, NP_702911.1:p.Met103Ile, NP_702913.1:p.Met167Ile, NP_702914.1:p.Met103Ile, NP_702915.1:p.Met84Ile, NP_702917.1:p.Met128Ile, NP_702918.1:p.Met84Ile, XM_005252010.1:c.441G>A, XM_005252011.1:c.384G>A, XM_005252012.1:c.309G>A, XM_005252012.2:c.309G>A, XM_005252013.1:c.309G>A, XM_005252013.2:c.309G>A, XM_005252014.1:c.309G>A, XM_005252014.2:c.309G>A, XM_005252015.1:c.309G>A, XM_005252016.1:c.309G>A, XM_005252016.2:c.309G>A, XM_005252017.1:c.294G>A, XM_005252017.3:c.294G>A, XM_005252018.1:c.294G>A, XM_005252019.1:c.294G>A, XM_005252019.2:c.294G>A, XM_005252020.1:c.294G>A, XM_005252020.2:c.294G>A, XM_005252021.1:c.382-2066G>A, XM_005252022.1:c.252G>A, XM_005252023.1:c.252G>A, XM_005252024.1:c.252G>A, XM_005252024.2:c.252G>A, XM_005252025.1:c.252G>A, XM_005252026.1:c.237G>A, XM_005252026.3:c.237G>A, XM_005252027.1:c.237G>A, XM_005252027.2:c.237G>A, XM_005252028.1:c.235-2066G>A, XM_005252029.1:c.252G>A, XM_006717126.2:c.309G>A, XM_011518722.1:c.558G>A, XM_011518723.1:c.501G>A, XM_011518724.1:c.426G>A, XM_011518725.1:c.426G>A, XM_011518726.1:c.426G>A, XM_011518727.1:c.426G>A, XM_011518728.1:c.426G>A, XM_011518729.1:c.426G>A, XM_011518730.1:c.558G>A, XM_011518731.1:c.499-2066G>A, XM_011518732.1:c.369G>A, XM_011518733.1:c.442-2066G>A, XM_011518734.1:c.315G>A, XM_011518735.1:c.309G>A, XM_011518736.1:c.294G>A, XM_011518737.1:c.252G>A, XM_011518738.1:c.325-2066G>A, XM_011518739.1:c.183G>A, XM_011518740.1:c.183G>A, XM_011518741.1:c.250-2066G>A, XM_011518742.1:c.193-2066G>A, XM_011518743.1:c.178-2066G>A, XM_011518744.1:c.384G>A, XP_005252067.1:p.Met147Ile, XP_005252068.1:p.Met128Ile, XP_005252069.1:p.Met103Ile, XP_005252070.1:p.Met103Ile, XP_005252071.1:p.Met103Ile, XP_005252072.1:p.Met103Ile, XP_005252073.1:p.Met103Ile, XP_005252074.1:p.Met98Ile, XP_005252075.1:p.Met98Ile, XP_005252076.1:p.Met98Ile, XP_005252077.1:p.Met98Ile, XP_005252079.1:p.Met84Ile, XP_005252080.1:p.Met84Ile, XP_005252081.1:p.Met84Ile, XP_005252082.1:p.Met84Ile, XP_005252083.1:p.Met79Ile, XP_005252084.1:p.Met79Ile, XP_005252086.1:p.Met84Ile, XP_006717189.1:p.Met103Ile, XP_011517024.1:p.Met186Ile, XP_011517025.1:p.Met167Ile, XP_011517026.1:p.Met142Ile, XP_011517027.1:p.Met142Ile, XP_011517028.1:p.Met142Ile, XP_011517029.1:p.Met142Ile, XP_011517030.1:p.Met142Ile, XP_011517031.1:p.Met142Ile, XP_011517032.1:p.Met186Ile, XP_011517034.1:p.Met123Ile, XP_011517036.1:p.Met105Ile, XP_011517037.1:p.Met103Ile, XP_011517038.1:p.Met98Ile, XP_011517039.1:p.Met84Ile, XP_011517041.1:p.Met61Ile, XP_011517042.1:p.Met61Ile, XP_011517046.1:p.Met128Ile
                                        20.

                                        rs778930202 [Homo sapiens]
                                          GTATGCTGAGCAGCTACACGTGCAA[C/T]TCGCTGACAAGGTCGCAGGCCCGCG
                                          Chromosome:
                                          9:128484875
                                          Gene:
                                          ODF2 (GeneView)
                                          Functional Consequence:
                                          missense
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000009.11:g.131247154C>T, NC_000009.12:g.128484875C>T, NG_029568.1:g.34721C>T, NM_001242352.1:c.1264C>T, NM_001242353.1:c.1279C>T, NM_001242354.1:c.1036C>T, NM_002540.4:c.1207C>T, NM_153432.1:c.1411C>T, NM_153433.1:c.1279C>T, NM_153435.1:c.1471C>T, NM_153436.1:c.1279C>T, NM_153437.2:c.1222C>T, NM_153439.1:c.1354C>T, NM_153440.1:c.1222C>T, NP_001229281.1:p.Leu422Phe, NP_001229282.1:p.Leu427Phe, NP_001229283.1:p.Leu346Phe, NP_002531.3:p.Leu403Phe, NP_702910.1:p.Leu471Phe, NP_702911.1:p.Leu427Phe, NP_702913.1:p.Leu491Phe, NP_702914.1:p.Leu427Phe, NP_702915.1:p.Leu408Phe, NP_702917.1:p.Leu452Phe, NP_702918.1:p.Leu408Phe, XM_005252010.1:c.1411C>T, XM_005252011.1:c.1354C>T, XM_005252012.1:c.1279C>T, XM_005252012.2:c.1279C>T, XM_005252013.1:c.1279C>T, XM_005252013.2:c.1279C>T, XM_005252014.1:c.1279C>T, XM_005252014.2:c.1279C>T, XM_005252015.1:c.1279C>T, XM_005252016.1:c.1279C>T, XM_005252016.2:c.1279C>T, XM_005252017.1:c.1264C>T, XM_005252017.3:c.1264C>T, XM_005252018.1:c.1264C>T, XM_005252019.1:c.1264C>T, XM_005252019.2:c.1264C>T, XM_005252020.1:c.1264C>T, XM_005252020.2:c.1264C>T, XM_005252021.1:c.1240C>T, XM_005252022.1:c.1222C>T, XM_005252023.1:c.1222C>T, XM_005252024.1:c.1222C>T, XM_005252024.2:c.1222C>T, XM_005252025.1:c.1222C>T, XM_005252026.1:c.1207C>T, XM_005252026.3:c.1207C>T, XM_005252027.1:c.1207C>T, XM_005252027.2:c.1207C>T, XM_005252028.1:c.1093C>T, XM_005252029.1:c.1222C>T, XM_005252030.1:c.559C>T, XM_006717126.2:c.1279C>T, XM_011518722.1:c.1528C>T, XM_011518723.1:c.1471C>T, XM_011518724.1:c.1396C>T, XM_011518725.1:c.1396C>T, XM_011518726.1:c.1396C>T, XM_011518727.1:c.1396C>T, XM_011518728.1:c.1396C>T, XM_011518729.1:c.1396C>T, XM_011518730.1:c.1528C>T, XM_011518731.1:c.1357C>T, XM_011518732.1:c.1339C>T, XM_011518733.1:c.1300C>T, XM_011518734.1:c.1285C>T, XM_011518735.1:c.1279C>T, XM_011518736.1:c.1264C>T, XM_011518737.1:c.1222C>T, XM_011518738.1:c.1183C>T, XM_011518739.1:c.1153C>T, XM_011518740.1:c.1153C>T, XM_011518741.1:c.1108C>T, XM_011518742.1:c.1051C>T, XM_011518743.1:c.1036C>T, XM_011518744.1:c.1354C>T, XP_005252067.1:p.Leu471Phe, XP_005252068.1:p.Leu452Phe, XP_005252069.1:p.Leu427Phe, XP_005252070.1:p.Leu427Phe, XP_005252071.1:p.Leu427Phe, XP_005252072.1:p.Leu427Phe, XP_005252073.1:p.Leu427Phe, XP_005252074.1:p.Leu422Phe, XP_005252075.1:p.Leu422Phe, XP_005252076.1:p.Leu422Phe, XP_005252077.1:p.Leu422Phe, XP_005252078.1:p.Leu414Phe, XP_005252079.1:p.Leu408Phe, XP_005252080.1:p.Leu408Phe, XP_005252081.1:p.Leu408Phe, XP_005252082.1:p.Leu408Phe, XP_005252083.1:p.Leu403Phe, XP_005252084.1:p.Leu403Phe, XP_005252085.1:p.Leu365Phe, XP_005252086.1:p.Leu408Phe, XP_005252087.1:p.Leu187Phe, XP_006717189.1:p.Leu427Phe, XP_011517024.1:p.Leu510Phe, XP_011517025.1:p.Leu491Phe, XP_011517026.1:p.Leu466Phe, XP_011517027.1:p.Leu466Phe, XP_011517028.1:p.Leu466Phe, XP_011517029.1:p.Leu466Phe, XP_011517030.1:p.Leu466Phe, XP_011517031.1:p.Leu466Phe, XP_011517032.1:p.Leu510Phe, XP_011517033.1:p.Leu453Phe, XP_011517034.1:p.Leu447Phe, XP_011517035.1:p.Leu434Phe, XP_011517036.1:p.Leu429Phe, XP_011517037.1:p.Leu427Phe, XP_011517038.1:p.Leu422Phe, XP_011517039.1:p.Leu408Phe, XP_011517040.1:p.Leu395Phe, XP_011517041.1:p.Leu385Phe, XP_011517042.1:p.Leu385Phe, XP_011517043.1:p.Leu370Phe, XP_011517044.1:p.Leu351Phe, XP_011517045.1:p.Leu346Phe, XP_011517046.1:p.Leu452Phe

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk