Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 774

1.

rs781654245 [Homo sapiens]
    AGCCACGCCATCATTGCGCCCGTCA[-/GCGCCT]GCGCCTGCGCCTGCGGCGACGCCAG
    Chromosome:
    1:154571899
    Gene:
    CHRNB2 (GeneView)
    Functional Consequence:
    cds indel
    Validated:
    no info
    HGVS:
    NC_000001.10:g.154544375_154544376insGCGCCT, NC_000001.11:g.154571899_154571900insGCGCCT, NG_008027.1:g.9119_9120insGCGCCT, NM_000748.2:c.1076_1077insGCGCCT, NP_000739.1:p.Arg364_Arg365insLeuArg
    2.

    rs781506269 [Homo sapiens]
      TCTTCTGGCTGCCGCCTGCCATCTA[C/T]AAGAGCGCATGCAAGATTGAAGTAA
      Chromosome:
      1:154571276
      Gene:
      CHRNB2 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      no info
      HGVS:
      NC_000001.10:g.154543752C>T, NC_000001.11:g.154571276C>T, NG_008027.1:g.8496C>T, NM_000748.2:c.453C>T, NP_000739.1:p.Tyr151
      3.

      rs781306131 [Homo sapiens]
        AGTGAGCTACCAGGAAGAGGGGCGC[C/T]GCCCCCACAGATCCATCCTTTTGCT
        Chromosome:
        1:154576032
        Gene:
        CHRNB2 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        no info
        HGVS:
        NC_000001.10:g.154548508T>C, NC_000001.11:g.154576032T>C, NG_008027.1:g.13252T>C, NM_000748.2:c.*100T>C
        4.

        rs781154968 [Homo sapiens]
          ATGCCCGCGGCATGGCCCGGCGCTG[C/T]GGCCCCGTGGCGCTGCTCCTTGGCT
          Chromosome:
          1:154568059
          Gene:
          CHRNB2 (GeneView)
          Functional Consequence:
          synonymous codon
          Validated:
          by frequency
          HGVS:
          NC_000001.10:g.154540535C>T, NC_000001.11:g.154568059C>T, NG_008027.1:g.5279C>T, NM_000748.2:c.15C>T, NP_000739.1:p.Cys5
          5.

          rs781099696 [Homo sapiens]
            CACCATCAACCTCATCATCCCCTGT[A/G]TGCTCATCACCTCGCTAGCCATCCT
            Chromosome:
            1:154571559
            Gene:
            CHRNB2 (GeneView)
            Functional Consequence:
            missense
            Validated:
            no info
            HGVS:
            NC_000001.10:g.154544035G>A, NC_000001.11:g.154571559G>A, NG_008027.1:g.8779G>A, NM_000748.2:c.736G>A, NP_000739.1:p.Val246Met
            6.

            rs781068734 [Homo sapiens]
              GACCACTCAGCCCCCAGCTCCAAGT[A/G]AGGCCCTTCCTCATCTCCATGCTCT
              Chromosome:
              1:154575931
              Gene:
              CHRNB2 (GeneView)
              Functional Consequence:
              synonymous codon
              Validated:
              no info
              HGVS:
              NC_000001.10:g.154548407G>A, NC_000001.11:g.154575931G>A, NG_008027.1:g.13151G>A, NM_000748.2:c.1508G>A, NP_000739.1:p.Ter503
              7.

              rs780962241 [Homo sapiens]
                GCTCGTCGGCAAGTACCTCATGTTC[A/G]CCATGGTGCTTGTCACCTTCTCCAT
                Chromosome:
                1:154571733
                Gene:
                CHRNB2 (GeneView)
                Functional Consequence:
                missense
                Clinical significance:
                Uncertain significance
                Validated:
                by frequency
                HGVS:
                NC_000001.10:g.154544209A>G, NC_000001.11:g.154571733A>G, NG_008027.1:g.8953A>G, NM_000748.2:c.910A>G, NP_000739.1:p.Thr304Ala
                8.

                rs780729841 [Homo sapiens]
                  GACCGTTTCCCCCAATGGTCTTGAA[A/G]CGGAAGAGGAAACAGGGAGGGCTCT
                  Chromosome:
                  1:154579180
                  Gene:
                  CHRNB2 (GeneView)
                  Functional Consequence:
                  utr variant 3 prime
                  Validated:
                  no info
                  HGVS:
                  NC_000001.10:g.154551656A>G, NC_000001.11:g.154579180A>G, NG_008027.1:g.16400A>G, NM_000748.2:c.*3248A>G
                  9.

                  rs780464481 [Homo sapiens]
                    ATGATGGCAGCATCTTCTGGCTGCC[G/T]CCTGCCATCTACAAGAGCGCATGCA
                    Chromosome:
                    1:154571264
                    Gene:
                    CHRNB2 (GeneView)
                    Functional Consequence:
                    synonymous codon
                    Validated:
                    no info
                    HGVS:
                    NC_000001.10:g.154543740G>T, NC_000001.11:g.154571264G>T, NG_008027.1:g.8484G>T, NM_000748.2:c.441G>T, NP_000739.1:p.Pro147
                    10.

                    rs780184576 [Homo sapiens]
                      TACACCATCAACCTCATCATCCCCT[-/G]TGTGCTCATCACCTCGCTAGCCATC
                      Chromosome:
                      1:154571557
                      Gene:
                      CHRNB2 (GeneView)
                      Functional Consequence:
                      frameshift variant
                      Validated:
                      by frequency
                      HGVS:
                      NC_000001.10:g.154544033delG, NC_000001.11:g.154571557delG, NG_008027.1:g.8777delG, NM_000748.2:c.734delG, NP_000739.1:p.Cys245Leufs
                      11.

                      rs780175030 [Homo sapiens]
                        CGTGGCGCTGCCGGGCCGGCGCAAC[A/G]AGAACCCCGACGACTCTACGTACGT
                        Chromosome:
                        1:154571463
                        Gene:
                        CHRNB2 (GeneView)
                        Functional Consequence:
                        missense
                        Clinical significance:
                        Uncertain significance
                        Validated:
                        by frequency
                        HGVS:
                        NC_000001.10:g.154543939G>A, NC_000001.11:g.154571463G>A, NG_008027.1:g.8683G>A, NM_000748.2:c.640G>A, NP_000739.1:p.Glu214Lys
                        12.

                        rs779771980 [Homo sapiens]
                          CCCTCTTCTTCCGCGAAGCCCCAGG[G/T]GCCGACTCCTGCACGTGCTTCGTCA
                          Chromosome:
                          1:154571972
                          Gene:
                          CHRNB2 (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          no info
                          HGVS:
                          NC_000001.10:g.154544448G>T, NC_000001.11:g.154571972G>T, NG_008027.1:g.9192G>T, NM_000748.2:c.1149G>T, NP_000739.1:p.Gly383
                          13.

                          rs779611230 [Homo sapiens]
                            CTCAGCATGCGTTGTCTTTATTCCG[C/T]GTGACAATCCTATGGGAAGGGGCCT
                            Chromosome:
                            1:154579309
                            Gene:
                            CHRNB2 (GeneView)
                            Functional Consequence:
                            utr variant 3 prime
                            Validated:
                            no info
                            HGVS:
                            NC_000001.10:g.154551785C>T, NC_000001.11:g.154579309C>T, NG_008027.1:g.16529C>T, NM_000748.2:c.*3377C>T
                            14.

                            rs779309344 [Homo sapiens]
                              CTCTTCCAGAACTACACCACCACCA[C/T]CTTCCTCCACTCAGACCACTCAGCC
                              Chromosome:
                              1:154575892
                              Gene:
                              CHRNB2 (GeneView)
                              Functional Consequence:
                              missense
                              Validated:
                              no info
                              HGVS:
                              NC_000001.10:g.154548368C>T, NC_000001.11:g.154575892C>T, NG_008027.1:g.13112C>T, NM_000748.2:c.1469C>T, NP_000739.1:p.Thr490Ile
                              15.

                              rs779199533 [Homo sapiens]
                                GAGTTTGACAACATGAAGAAAGTTC[A/G]GCTCCCTTCCAAACACATCTGGCTC
                                Chromosome:
                                1:154570319
                                Gene:
                                CHRNB2 (GeneView)
                                Functional Consequence:
                                missense
                                Clinical significance:
                                Uncertain significance
                                Validated:
                                no info
                                HGVS:
                                NC_000001.10:g.154542795G>A, NC_000001.11:g.154570319G>A, NG_008027.1:g.7539G>A, NM_000748.2:c.317G>A, NP_000739.1:p.Arg106Gln
                                16.

                                rs779081556 [Homo sapiens]
                                  GCAAGCCGCTCTTCTACACCATCAA[A/C]CTCATCATCCCCTGTGTGCTCATCA
                                  Chromosome:
                                  1:154571543
                                  Gene:
                                  CHRNB2 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000001.10:g.154544019C>A, NC_000001.11:g.154571543C>A, NG_008027.1:g.8763C>A, NM_000748.2:c.720C>A, NP_000739.1:p.Asn240Lys
                                  17.

                                  rs779023843 [Homo sapiens]
                                    CGCACACCATGGCGCCCTGGGTGAA[A/G]GTCGTCTTCCTGGAGAAGCTGCCCG
                                    Chromosome:
                                    1:154571831
                                    Gene:
                                    CHRNB2 (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000001.10:g.154544307G>A, NC_000001.11:g.154571831G>A, NG_008027.1:g.9051G>A, NM_000748.2:c.1008G>A, NP_000739.1:p.Lys336
                                    18.

                                    rs778805995 [Homo sapiens]
                                      AAGGCAGCTTCCTGGCGGGGAGATA[G/T]AAATACTAGAACAGCTGGTACCAAG
                                      Chromosome:
                                      1:154579044
                                      Gene:
                                      CHRNB2 (GeneView)
                                      Functional Consequence:
                                      utr variant 3 prime
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000001.10:g.154551520G>T, NC_000001.11:g.154579044G>T, NG_008027.1:g.16264G>T, NM_000748.2:c.*3112G>T
                                      19.

                                      rs778714852 [Homo sapiens]
                                        GCGACGCCAGCGTGAGCGCGAGGGC[A/G]CTGGAGCCCTCTTCTTCCGCGAAGC
                                        Chromosome:
                                        1:154571940
                                        Gene:
                                        CHRNB2 (GeneView)
                                        Functional Consequence:
                                        missense
                                        Validated:
                                        by frequency
                                        HGVS:
                                        NC_000001.10:g.154544416G>A, NC_000001.11:g.154571940G>A, NG_008027.1:g.9160G>A, NM_000748.2:c.1117G>A, NP_000739.1:p.Ala373Thr
                                        20.

                                        rs778537596 [Homo sapiens]
                                          TGGTGATCGACCGCCTCTTCCTCTG[A/G]ATCTTTGTCTTTGTCTGTGTCTTTG
                                          Chromosome:
                                          1:154575815
                                          Gene:
                                          CHRNB2 (GeneView)
                                          Functional Consequence:
                                          stop gained
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000001.10:g.154548291G>A, NC_000001.11:g.154575815G>A, NG_008027.1:g.13035G>A, NM_000748.2:c.1392G>A, NP_000739.1:p.Trp464Ter

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Write to the Help Desk