Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 589

1.

rs781404325 [Homo sapiens]
    AGGCCAGGCGGCACCGCCACCTCCT[C/T]TCCCCGTAGACAGCGGCCCCGAAAC
    Chromosome:
    11:65720379
    Gene:
    RNASEH2C (GeneView)
    Functional Consequence:
    missense
    Validated:
    no info
    HGVS:
    NC_000011.10:g.65720379C>T, NC_000011.9:g.65487850C>T, NG_008976.2:g.5560G>A, NG_033057.1:g.13378C>T, NM_032193.3:c.211G>A, NP_115569.2:p.Glu71Lys
    2.

    rs781376271 [Homo sapiens]
      TCGTCTACTCACCGCTGCCGCAAGG[C/T]TGGGCCAAGTTAAGGCCCCACGCAC
      Chromosome:
      11:65720058
      Gene:
      KAT5 (GeneView) RNASEH2C (GeneView)
      Functional Consequence:
      downstream variant 500B,missense
      Validated:
      by frequency
      HGVS:
      NC_000011.10:g.65720058C>T, NC_000011.9:g.65487529C>T, NG_008976.2:g.5881G>A, NG_033057.1:g.13057C>T, NM_001206833.1:c.*877C>T, NM_006388.3:c.*877C>T, NM_032193.3:c.455G>A, NM_182709.2:c.*877C>T, NM_182710.2:c.*877C>T, NP_115569.2:p.Ser152Asn, XM_006718421.1:c.*877C>T
      3.

      rs781351230 [Homo sapiens]
        GAATCCCGCAAGGGGTCTGGCTTCC[C/T]CATCGACACCTTCTTCTCTTCTGTC
        Chromosome:
        11:65720310
        Gene:
        RNASEH2C (GeneView)
        Functional Consequence:
        missense
        Validated:
        no info
        HGVS:
        NC_000011.10:g.65720310C>T, NC_000011.9:g.65487781C>T, NG_008976.2:g.5629G>A, NG_033057.1:g.13309C>T, NM_032193.3:c.280G>A, NP_115569.2:p.Gly94Arg
        4.

        rs781300192 [Homo sapiens]
          AAGAGCTGGTTTACTGCTGTGAAGG[A/G]ATCGCAGCTTTGAATTTCAAGCTCT
          Chromosome:
          11:65719752
          Gene:
          KAT5 (GeneView) RNASEH2C (GeneView)
          Functional Consequence:
          downstream variant 500B,utr variant 3 prime
          Validated:
          no info
          HGVS:
          NC_000011.10:g.65719752G>A, NC_000011.9:g.65487223G>A, NG_008976.2:g.6187C>T, NG_033057.1:g.12751G>A, NM_001206833.1:c.*571G>A, NM_006388.3:c.*571G>A, NM_032193.3:c.*31C>T, NM_182709.2:c.*571G>A, NM_182710.2:c.*571G>A, XM_006718421.1:c.*571G>A
          5.

          rs781290873 [Homo sapiens]
            GCAACCTCGCAGGGCAGCAGATGCA[A/G]TGTGGCGGGTACGGCGTCGCGCAAT
            Chromosome:
            11:65720674
            Gene:
            RNASEH2C (GeneView)
            Functional Consequence:
            synonymous codon
            Validated:
            no info
            HGVS:
            NC_000011.10:g.65720674G>A, NC_000011.9:g.65488145G>A, NG_008976.2:g.5265C>T, NG_033057.1:g.13673G>A, NM_032193.3:c.85C>T, NP_115569.2:p.Leu29
            6.

            rs781285194 [Homo sapiens]
              GTTGGACTTGTAAGACAGGGCGGCA[A/G]GCTGGCCCCCATACCCGAGGAAGGA
              Chromosome:
              11:65719858
              Gene:
              KAT5 (GeneView) RNASEH2C (GeneView)
              Functional Consequence:
              downstream variant 500B,intron variant
              Validated:
              no info
              HGVS:
              NC_000011.10:g.65719858A>G, NC_000011.9:g.65487329A>G, NG_008976.2:g.6081T>C, NG_033057.1:g.12857A>G, NM_001206833.1:c.*677A>G, NM_006388.3:c.*677A>G, NM_032193.3:c.469-49T>C, NM_182709.2:c.*677A>G, NM_182710.2:c.*677A>G, XM_006718421.1:c.*677A>G
              7.

              rs781241858 [Homo sapiens]
                GGGAAGTGGTGACCAGACACTGCCC[A/G]CTGCAGTGCCAAGACGGCAGCAGGA
                Chromosome:
                11:65719195
                Gene:
                KAT5 (GeneView) RNASEH2C (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by frequency
                HGVS:
                NC_000011.10:g.65719195A>G, NC_000011.9:g.65486666A>G, NG_008976.2:g.6744T>C, NG_033057.1:g.12194A>G, NM_001206833.1:c.*14A>G, NM_006388.3:c.*14A>G, NM_032193.3:c.*588T>C, NM_182709.2:c.*14A>G, NM_182710.2:c.*14A>G, XM_006718421.1:c.*14A>G
                8.

                rs781232402 [Homo sapiens]
                  CGGGAGCCGTAGTCCGGCCGCAGGG[C/T]TCACCCTCGGGGCCCTGGCGGATGG
                  Chromosome:
                  11:65720582
                  Gene:
                  RNASEH2C (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  NC_000011.10:g.65720582C>T, NC_000011.9:g.65488053C>T, NG_008976.2:g.5357G>A, NG_033057.1:g.13581C>T, NM_032193.3:c.172+5G>A
                  9.

                  rs781129649 [Homo sapiens]
                    ACATGCTAGGAAGAGTGGTCAGGGA[A/G]CTACGCTTCCCACACACTACCCAGT
                    Chromosome:
                    11:65719937
                    Gene:
                    KAT5 (GeneView) RNASEH2C (GeneView)
                    Functional Consequence:
                    downstream variant 500B,intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000011.10:g.65719937G>A, NC_000011.9:g.65487408G>A, NG_008976.2:g.6002C>T, NG_033057.1:g.12936G>A, NM_001206833.1:c.*756G>A, NM_006388.3:c.*756G>A, NM_032193.3:c.468+108C>T, NM_182709.2:c.*756G>A, NM_182710.2:c.*756G>A, XM_006718421.1:c.*756G>A
                    10.

                    rs781108371 [Homo sapiens]
                      GACTCTGAACTTCATCACACATGGG[C/T]TCTTCAGTGCCCTCCCCAACCCTGA
                      Chromosome:
                      11:65717497
                      Gene:
                      KAT5 (GeneView) RNASEH2C (GeneView)
                      Functional Consequence:
                      downstream variant 500B,intron variant
                      Validated:
                      no info
                      HGVS:
                      NC_000011.10:g.65717497C>T, NC_000011.9:g.65484968C>T, NG_008976.2:g.8442G>A, NG_033057.1:g.10496C>T, NM_001206833.1:c.1108+515C>T, NM_006388.3:c.1165+515C>T, NM_032193.3:c.*2286G>A, NM_182709.2:c.1009+515C>T, NM_182710.2:c.1264+515C>T, XM_006718421.1:c.1192+515C>T, XM_011544733.1:c.1196+511C>T
                      11.

                      rs780848408 [Homo sapiens]
                        GAAGCGGCTGAAGTTGGCAGTGGCT[C/T]CAATGAAGCGGTCCTGGGGAAGGGG
                        Chromosome:
                        11:65720151
                        Gene:
                        RNASEH2C (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        no info
                        HGVS:
                        NC_000011.10:g.65720151C>T, NC_000011.9:g.65487622C>T, NG_008976.2:g.5788G>A, NG_033057.1:g.13150C>T, NM_032193.3:c.362G>A, NP_115569.2:p.Gly121Glu
                        12.

                        rs780822604 [Homo sapiens]
                          CTGTGACCTCTTACTCACCCTCTCC[C/T]GCTCCATTGCTTTAGGCTATGAACT
                          Chromosome:
                          11:65718574
                          Gene:
                          KAT5 (GeneView) RNASEH2C (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          no info
                          HGVS:
                          NC_000011.10:g.65718574T>C, NC_000011.9:g.65486045T>C, NG_008976.2:g.7365A>G, NG_033057.1:g.11573T>C, NM_001206833.1:c.1109-16T>C, NM_006388.3:c.1166-16T>C, NM_032193.3:c.*1209A>G, NM_182709.2:c.1010-16T>C, NM_182710.2:c.1265-16T>C, XM_006718421.1:c.1193-16T>C, XM_011544733.1:c.1197-16T>C
                          13.

                          rs780568282 [Homo sapiens]
                            GAGTGCCAGGCACGGTCTCAGCTCA[C/T]TGCAACCTCCGCCTCCCGGGTTCAA
                            Chromosome:
                            11:65721192
                            Gene:
                            RNASEH2C (GeneView)
                            Functional Consequence:
                            upstream variant 2KB
                            Validated:
                            no info
                            HGVS:
                            NC_000011.10:g.65721192C>T, NC_000011.9:g.65488663C>T, NG_008976.2:g.4747G>A, NG_033057.1:g.14191C>T, NM_032193.3:c.-434G>A
                            14.

                            rs780561385 [Homo sapiens]
                              GGACTACAGCTCCCGCCCGCACCCC[C/T]TTTCAACCCTATCCCTTTGCTCACG
                              Chromosome:
                              11:65720217
                              Gene:
                              RNASEH2C (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000011.10:g.65720217C>T, NC_000011.9:g.65487688C>T, NG_008976.2:g.5722G>A, NG_033057.1:g.13216C>T, NM_032193.3:c.348+25G>A
                              15.
                              16.

                              rs780260172 [Homo sapiens]
                                AGGGATCGCAGCTTTGAATTTCAAG[C/T]TCTGGTTCTCAGTCCTCGGGCACCT
                                Chromosome:
                                11:65719774
                                Gene:
                                KAT5 (GeneView) RNASEH2C (GeneView)
                                Functional Consequence:
                                downstream variant 500B,utr variant 3 prime
                                Validated:
                                no info
                                HGVS:
                                NC_000011.10:g.65719774C>T, NC_000011.9:g.65487245C>T, NG_008976.2:g.6165G>A, NG_033057.1:g.12773C>T, NM_001206833.1:c.*593C>T, NM_006388.3:c.*593C>T, NM_032193.3:c.*9G>A, NM_182709.2:c.*593C>T, NM_182710.2:c.*593C>T, XM_006718421.1:c.*593C>T
                                17.

                                rs780097976 [Homo sapiens]
                                  AACAGGAGTCGCCTCTACTGTTGGA[C/T]TTGTAAGACAGGGCGGCAAGCTGGC
                                  Chromosome:
                                  11:65719839
                                  Gene:
                                  KAT5 (GeneView) RNASEH2C (GeneView)
                                  Functional Consequence:
                                  downstream variant 500B,intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000011.10:g.65719839C>T, NC_000011.9:g.65487310C>T, NG_008976.2:g.6100G>A, NG_033057.1:g.12838C>T, NM_001206833.1:c.*658C>T, NM_006388.3:c.*658C>T, NM_032193.3:c.469-30G>A, NM_182709.2:c.*658C>T, NM_182710.2:c.*658C>T, XM_006718421.1:c.*658C>T
                                  18.

                                  rs780094685 [Homo sapiens]
                                    GGGTCGAGCCCGGAGCTGCCCTCCC[
                                    -/CCCCATTCT
                                    ]GCCACCTCCGGACGGACCACGATCC
                                    Chromosome:
                                    11:65720484
                                    Gene:
                                    RNASEH2C (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000011.10:g.65720484_65720485insCCCCATTCT, NC_000011.9:g.65487955_65487956insCCCCATTCT, NG_008976.2:g.5454_5455insAGAATGGGG, NG_033057.1:g.13483_13484insCCCCATTCT, NM_032193.3:c.173-68_173-67insAGAATGGGG
                                    19.

                                    rs780092534 [Homo sapiens]
                                      AGGCAGGACCCACGCTGGGTCGAGC[C/T]CGGAGCTGCCCTCCCGCCACCTCCG
                                      Chromosome:
                                      11:65720469
                                      Gene:
                                      RNASEH2C (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000011.10:g.65720469C>T, NC_000011.9:g.65487940C>T, NG_008976.2:g.5470G>A, NG_033057.1:g.13468C>T, NM_032193.3:c.173-52G>A
                                      20.

                                      rs780046269 [Homo sapiens]
                                        CGCAATTGTGCTCCCCAGCCCATCC[A/C]CCCGGGGGCAAGACGGAACTCCTCG
                                        Chromosome:
                                        11:65720010
                                        Gene:
                                        KAT5 (GeneView) RNASEH2C (GeneView)
                                        Functional Consequence:
                                        downstream variant 500B,intron variant
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000011.10:g.65720010A>C, NC_000011.9:g.65487481A>C, NG_008976.2:g.5929T>G, NG_033057.1:g.13009A>C, NM_001206833.1:c.*829A>C, NM_006388.3:c.*829A>C, NM_032193.3:c.468+35T>G, NM_182709.2:c.*829A>C, NM_182710.2:c.*829A>C, XM_006718421.1:c.*829A>C

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Write to the Help Desk