Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 1483

4.
5.

rs796796034 [Homo sapiens]
    GCTTGAGCTCAGGAGTTCCAGACCA[C/G]CCTGGGCAACATGGCCAAACCGTGT
    Chromosome:
    16:58014588
    Gene:
    USB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000016.10:g.58014588G>C, NC_000016.9:g.58048492G>C, NG_027698.1:g.18216G>C, NM_001195302.1:c.450-2746G>C, NM_024598.3:c.503+262G>C, XM_005256144.1:c.350+262G>C, XM_005256144.3:c.350+262G>C, XM_005256145.1:c.350+262G>C, XM_011523328.1:c.464+262G>C, XM_011523329.1:c.350+262G>C
    7.

    rs796656284 [Homo sapiens]
      TCTGTGAATACGACTGTCTTAGCTC[A/G]GGCTGTCATAACAAAATACCATAGA
      Chromosome:
      16:58018113
      Gene:
      USB1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000016.10:g.58018113A>G, NC_000016.9:g.58052017A>G, NG_027698.1:g.21741A>G, NM_001195302.1:c.555+674A>G, NM_024598.3:c.609+674A>G, XM_005256144.1:c.456+674A>G, XM_005256144.3:c.456+674A>G, XM_005256145.1:c.456+674A>G, XM_011523328.1:c.570+674A>G, XM_011523329.1:c.456+674A>G
      11.

      rs796285222 [Homo sapiens]
        CCTCTCTCTTCCCTTCCTGTCTCTC[C/T]TCCCCTCCTCTCTCTCTTCCTGTCC
        Chromosome:
        16:58020678
        Gene:
        USB1 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        no info
        HGVS:
        NC_000016.10:g.58020678T>C, NC_000016.9:g.58054582T>C, NG_027698.1:g.24306T>C, NM_001195302.1:c.*433T>C, NM_024598.3:c.*433T>C, XM_005256144.1:c.*433T>C, XM_005256144.3:c.*433T>C, XM_005256145.1:c.*433T>C, XM_011523328.1:c.*433T>C, XM_011523329.1:c.*433T>C
        16.

        rs781682471 [Homo sapiens]
          CAGGTAATGAATGGGGCTGCTGCTT[C/G]TCCATTGACCCATTTCTAATGAGAA
          Chromosome:
          16:58017462
          Gene:
          USB1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by frequency
          HGVS:
          NC_000016.10:g.58017462C>G, NC_000016.9:g.58051366C>G, NG_027698.1:g.21090C>G, NM_001195302.1:c.555+23C>G, NM_024598.3:c.609+23C>G, XM_005256144.1:c.456+23C>G, XM_005256144.3:c.456+23C>G, XM_005256145.1:c.456+23C>G, XM_011523328.1:c.570+23C>G, XM_011523329.1:c.456+23C>G
          17.

          rs781610947 [Homo sapiens]
            CCTCGCCCAGCCTCTGAAGTTGGGT[G/T]AGCTGGTTTTGTTTGCAGTGCCCTG
            Chromosome:
            16:58020062
            Gene:
            USB1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            HGVS:
            NC_000016.10:g.58020062G>T, NC_000016.9:g.58053966G>T, NG_027698.1:g.23690G>T, NM_001195302.1:c.640-79G>T, NM_024598.3:c.694-79G>T, XM_005256144.1:c.541-79G>T, XM_005256144.3:c.541-79G>T, XM_005256145.1:c.541-79G>T, XM_011523328.1:c.655-79G>T, XM_011523329.1:c.541-79G>T
            18.

            rs781609897 [Homo sapiens]
              ACAGGTGCGCCAGGTCGTGACCACA[C/T]ACGCCACATTTGGGGCCTGGCTCTC
              Chromosome:
              16:57998026
              Gene:
              USB1 (GeneView) ZNF319 (GeneView)
              Functional Consequence:
              synonymous codon,upstream variant 2KB
              Validated:
              no info
              HGVS:
              NC_000016.10:g.57998026C>T, NC_000016.9:g.58031930C>T, NG_027698.1:g.1654C>T, NM_020807.2:c.240G>A, NP_065858.1:p.Val80, XM_005256069.1:c.240G>A, XM_005256069.2:c.240G>A, XM_005256144.1:c.-1713C>T, XM_005256144.3:c.-1713C>T, XM_005256145.1:c.-1816C>T, XM_011523329.1:c.-1816C>T, XP_005256126.1:p.Val80
              19.

              rs781550706 [Homo sapiens]
                AGCATGTTTGAGGAGGCCAGTGAGG[C/G]AGACCCCAGAAAGCACGAGGGAGAA
                Chromosome:
                16:58015851
                Gene:
                USB1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by cluster
                HGVS:
                NC_000016.10:g.58015851C>G, NC_000016.9:g.58049755C>G, NG_027698.1:g.19479C>G, NM_001195302.1:c.450-1483C>G, NM_024598.3:c.504-1483C>G, XM_005256144.1:c.351-1483C>G, XM_005256144.3:c.351-1483C>G, XM_005256145.1:c.351-1483C>G, XM_011523328.1:c.465-1483C>G, XM_011523329.1:c.351-1483C>G

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Write to the Help Desk