Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 436

1.

rs782816361 [Homo sapiens]
    CATAGATTGGGTGGCTTTTAAATGA[C/T]AAATTTATTTCTCACAGCTCTGGAG
    Chromosome:
    X:154149608
    Gene:
    OPN1LW (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by frequency
    Global MAF:
    C=0.0008/3
    HGVS:
    NC_000023.10:g.153415080T>C, NC_000023.11:g.154149608T>C, NG_009105.2:g.10358T>C, NM_020061.5:c.113-1048T>C, NW_003871103.3:g.1583587T>C
    2.

    rs782815809 [Homo sapiens]
    • Suspected
    AGTGTCTGGATGATCTTTGTGGTCA[C/T]TGCATCCGTCTTCACAAATGGGCTT
    Chromosome:
    X:154150737
    Gene:
    OPN1LW (GeneView)
    Functional Consequence:
    missense
    Validated:
    by frequency
    HGVS:
    NC_000023.10:g.153416209C>T, NC_000023.11:g.154150737C>T, NG_009105.2:g.11487C>T, NM_020061.5:c.194C>T, NP_064445.2:p.Thr65Ile, NW_003871103.3:g.1584716C>T
    3.

    rs782813028 [Homo sapiens]
      AATCATAATCATAATCAGGACAGCC[A/G]TCATATTGGATTAGGGCCCACCCTA
      Chromosome:
      X:154148619
      Gene:
      OPN1LW (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0011/4
      HGVS:
      NC_000023.10:g.153414092G>A, NC_000023.11:g.154148619G>A, NG_009105.2:g.9369G>A, NM_020061.5:c.113-2037G>A, NW_003871103.3:g.1582598G>A
      4.

      rs782811955 [Homo sapiens]
        TGACCCTCAGGTGATGCGCCAGGGC[C/T]GGCTGCCGTCGGGGACAGGGCTTTC
        Chromosome:
        X:154144251
        Gene:
        OPN1LW (GeneView)
        Functional Consequence:
        utr variant 5 prime
        Validated:
        by frequency
        HGVS:
        NC_000023.10:g.153409725C>T, NC_000023.11:g.154144251C>T, NG_009105.2:g.5001C>T, NM_020061.5:c.-33C>T, NW_003871103.3:g.1578230C>T
        5.

        rs782809344 [Homo sapiens]
          GCTTTTGCCTCCCCCGCCATCTCCA[A/C]CTTGTTAACTCCTTCATTCTCCACG
          Chromosome:
          X:154155942
          Gene:
          OPN1LW (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by frequency
          Global MAF:
          A=0.0032/12
          HGVS:
          NC_000023.10:g.153421417C>A, NC_000023.11:g.154155942C>A, NG_009105.2:g.16692C>A, NM_020061.5:c.745-352C>A, NW_003871103.3:g.1589921C>A
          6.

          rs782800914 [Homo sapiens]
            GCCTCGCAAGGAGGATCCGGTTCCA[A/G]GCCTCGGCCCTAAATAGTCTCCCTG
            Chromosome:
            X:154143803
            Gene:
            OPN1LW (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by frequency
            Global MAF:
            A=0.0013/5
            HGVS:
            NC_000023.10:g.153409277G>A, NC_000023.11:g.154143803G>A, NG_009105.2:g.4553G>A, NM_020061.5:c.-481G>A, NW_003871103.3:g.1577782G>A
            7.

            rs782799009 [Homo sapiens]
              TTCACAGAGATGGAGCCATGCGCTC[C/T]GTGGTCTTTTGTGTCTGGCTTCGCT
              Chromosome:
              X:154142670
              Gene:
              OPN1LW (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              no info
              HGVS:
              NC_000023.10:g.153408144C>T, NC_000023.11:g.154142670C>T, NG_009105.2:g.3420C>T, NM_020061.5:c.-1614C>T, NW_003871103.3:g.1576649C>T
              8.

              rs782797093 [Homo sapiens]
                TTCCACCCTTTGATGGCTGCCCTGC[C/T]GGCCTACTTTGCCAAAAGTGCCACT
                Chromosome:
                X:154156469
                Gene:
                OPN1LW (GeneView)
                Functional Consequence:
                missense
                Validated:
                no info
                HGVS:
                NC_000023.10:g.153421944C>T, NC_000023.11:g.154156469C>T, NG_009105.2:g.17219C>T, NM_020061.5:c.920C>T, NP_064445.2:p.Pro307Leu, NW_003871103.3:g.1590448C>T
                9.

                rs782793124 [Homo sapiens]
                  ATCTTCACCTACACCAACAGCAACT[C/T]CACCAGAGGTGAGCCAGCAGGCCCG
                  Chromosome:
                  X:154144387
                  Gene:
                  OPN1LW (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  by frequency
                  HGVS:
                  NC_000023.10:g.153409861C>T, NC_000023.11:g.154144387C>T, NG_009105.2:g.5137C>T, NM_020061.5:c.104C>T, NP_064445.2:p.Ser35Phe, NW_003871103.3:g.1578366C>T
                  10.

                  rs782789511 [Homo sapiens]
                    TCCACCTGCCCCAAAGGCGGACGCA[A/G]GACAGTAGAAGGGAACAGAGAACAC
                    Chromosome:
                    X:154143944
                    Gene:
                    OPN1LW (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    by 1000G,by frequency
                    Global MAF:
                    A=0.0008/3
                    HGVS:
                    NC_000023.10:g.153409418G>A, NC_000023.11:g.154143944G>A, NG_009105.2:g.4694G>A, NM_020061.5:c.-340G>A, NW_003871103.3:g.1577923G>A
                    11.

                    rs782786685 [Homo sapiens]
                      GATGATCTTTGTGGTCACTGCATCC[A/G]TCTTCACAAATGGGCTTGTGCTGGC
                      Chromosome:
                      X:154150745
                      Gene:
                      OPN1LW (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      by 1000G,by cluster
                      Global MAF:
                      A=0.0003/1
                      HGVS:
                      NC_000023.10:g.153416217G>A, NC_000023.11:g.154150745G>A, NG_009105.2:g.11495G>A, NM_020061.5:c.202G>A, NP_064445.2:p.Val68Ile, NW_003871103.3:g.1584724G>A
                      12.

                      rs782786462 [Homo sapiens]
                        GCTTTGCTTCCCACCTTTGCTTTGG[C/G]TCAAAGCCCTCATCTGTCTGCTCTC
                        Chromosome:
                        X:154152907
                        Gene:
                        OPN1LW (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by frequency
                        HGVS:
                        NC_000023.10:g.153418380C>G, NC_000023.11:g.154152907C>G, NG_009105.2:g.13657C>G, NM_020061.5:c.410-33C>G, NW_003871103.3:g.1586886C>G
                        13.

                        rs782783784 [Homo sapiens]
                          CCCAGAAGGCAGAGAAGGAAGTGAC[A/G]CGCATGGTGGTGGTGATGATCTTTG
                          Chromosome:
                          X:154156350
                          Gene:
                          OPN1LW (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          by frequency
                          HGVS:
                          NC_000023.10:g.153421825G>A, NC_000023.11:g.154156350G>A, NG_009105.2:g.17100G>A, NM_020061.5:c.801G>A, NP_064445.2:p.Thr267, NW_003871103.3:g.1590329G>A
                          14.

                          rs782783558 [Homo sapiens]
                            CCACATCGCTCCCAGATGGGTGTAC[C/T]ACCTCACCAGTGTCTGGATGATCTT
                            Chromosome:
                            X:154150703
                            Gene:
                            OPN1LW (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            no info
                            HGVS:
                            NC_000023.10:g.153416175C>T, NC_000023.11:g.154150703C>T, NG_009105.2:g.11453C>T, NM_020061.5:c.160C>T, NP_064445.2:p.His54Tyr, NW_003871103.3:g.1584682C>T
                            15.

                            rs782777199 [Homo sapiens]
                              GCCAACCCTGGTTACGCCTTCCACC[C/G]TTTGATGGCTGCCCTGCCGGCCTAC
                              Chromosome:
                              X:154156451
                              Gene:
                              OPN1LW (GeneView)
                              Functional Consequence:
                              missense
                              Validated:
                              no info
                              HGVS:
                              NC_000023.10:g.153421926C>G, NC_000023.11:g.154156451C>G, NG_009105.2:g.17201C>G, NM_020061.5:c.902C>G, NP_064445.2:p.Pro301Arg, NW_003871103.3:g.1590430C>G
                              16.

                              rs782765931 [Homo sapiens]
                                GTTGGAGCAGGTAAGGGTGCGAGGA[-/CC]CGCAAGATGGAGTGGGCAGGGTCAG
                                Chromosome:
                                X:154153123
                                Gene:
                                OPN1LW (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                HGVS:
                                NC_000023.10:g.153418596_153418597insCC, NC_000023.11:g.154153123_154153124insCC, NG_009105.2:g.13873_13874insCC, NM_020061.5:c.578+15_578+16insCC, NW_003871103.3:g.1587102_1587103insCC
                                17.

                                rs782762187 [Homo sapiens]
                                  TGCCACTGCACTCCAGCCTGGGTGA[-/C]AGAGCAAGACTCCGTCTCAAAAAAA
                                  Chromosome:
                                  X:154149186
                                  Gene:
                                  OPN1LW (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by frequency
                                  Global MAF:
                                  -=0.0029/11
                                  HGVS:
                                  NC_000023.10:g.153414659delC, NC_000023.11:g.154149186delC, NG_009105.2:g.9936delC, NM_020061.5:c.113-1470delC, NW_003871103.3:g.1583165delC
                                  18.

                                  rs782757739 [Homo sapiens]
                                    TTTTATCACCCATAAAGCACTCCCT[A/G]TACCCATTAAGAAGTCATCCTCCAT
                                    Chromosome:
                                    X:154142549
                                    Gene:
                                    OPN1LW (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    by 1000G,by frequency
                                    Global MAF:
                                    A=0.0005/2
                                    HGVS:
                                    NC_000023.10:g.153408023G>A, NC_000023.11:g.154142549G>A, NG_009105.2:g.3299G>A, NM_020061.5:c.-1735G>A, NW_003871103.3:g.1576528G>A
                                    19.

                                    rs782755469 [Homo sapiens]
                                      AGACGTGTTCAGCGGCAGCTCGTAC[C/T]CCGGGGTGCAGTCTTACATGATTGT
                                      Chromosome:
                                      X:154154635
                                      Gene:
                                      OPN1LW (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000023.10:g.153420110C>T, NC_000023.11:g.154154635C>T, NG_009105.2:g.15385C>T, NM_020061.5:c.640C>T, NP_064445.2:p.Pro214Ser, NW_003871103.3:g.1588614C>T
                                      20.

                                      rs782754056 [Homo sapiens]
                                        AAGGGTGCGAGGACGCAAGATGGAG[C/T]GGGCAGGGTCAGACTCTGTGACCTT
                                        Chromosome:
                                        X:154153136
                                        Gene:
                                        OPN1LW (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000023.10:g.153418609T>C, NC_000023.11:g.154153136T>C, NG_009105.2:g.13886T>C, NM_020061.5:c.578+28T>C, NW_003871103.3:g.1587115T>C

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Write to the Help Desk