Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 12

  • The following term was not found in SNP: endocrinology.
1.

rs5882 [Homo sapiens]
    TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
    Chromosome:
    16:56982180
    Gene:
    CETP (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.4661/2334
    HGVS:
    NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
    2.

    rs289738 has merged into rs5882 [Homo sapiens]
      TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
      Chromosome:
      16:56982180
      Gene:
      CETP (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.4661/2334
      HGVS:
      NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
      3.

      rs1131843 has merged into rs5882 [Homo sapiens]
        TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
        Chromosome:
        16:56982180
        Gene:
        CETP (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        G=0.4661/2334
        HGVS:
        NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
        4.

        rs1613122 has merged into rs5882 [Homo sapiens]
          TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
          Chromosome:
          16:56982180
          Gene:
          CETP (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          G=0.4661/2334
          HGVS:
          NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
          5.

          rs1801707 has merged into rs5882 [Homo sapiens]
            TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
            Chromosome:
            16:56982180
            Gene:
            CETP (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            G=0.4661/2334
            HGVS:
            NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
            6.

            rs3192075 has merged into rs5882 [Homo sapiens]
              TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
              Chromosome:
              16:56982180
              Gene:
              CETP (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.4661/2334
              HGVS:
              NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
              7.

              rs12720881 has merged into rs5882 [Homo sapiens]
                TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                Chromosome:
                16:56982180
                Gene:
                CETP (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                G(germline)/A(germline)
                Clinical significance:
                other
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                G=0.4661/2334
                HGVS:
                NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
                8.

                rs17231896 has merged into rs5882 [Homo sapiens]
                  TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                  Chromosome:
                  16:56982180
                  Gene:
                  CETP (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  other
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  G=0.4661/2334
                  HGVS:
                  NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
                  9.

                  rs17414131 has merged into rs5882 [Homo sapiens]
                    TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                    Chromosome:
                    16:56982180
                    Gene:
                    CETP (GeneView)
                    Functional Consequence:
                    missense
                    Allele Origin:
                    G(germline)/A(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    G=0.4661/2334
                    HGVS:
                    NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
                    10.

                    rs17845778 has merged into rs5882 [Homo sapiens]
                      TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                      Chromosome:
                      16:56982180
                      Gene:
                      CETP (GeneView)
                      Functional Consequence:
                      missense
                      Allele Origin:
                      G(germline)/A(germline)
                      Clinical significance:
                      other
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.4661/2334
                      HGVS:
                      NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
                      11.

                      rs17858738 has merged into rs5882 [Homo sapiens]
                        TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                        Chromosome:
                        16:56982180
                        Gene:
                        CETP (GeneView)
                        Functional Consequence:
                        missense
                        Allele Origin:
                        G(germline)/A(germline)
                        Clinical significance:
                        other
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.4661/2334
                        HGVS:
                        NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile
                        12.

                        rs61212082 has merged into rs5882 [Homo sapiens]
                          TGATTGGCAGAGCAGCTCCGAGTCC[A/G]TCCAGAGCTTCCTGCAGTCAATGAT
                          Chromosome:
                          16:56982180
                          Gene:
                          CETP (GeneView)
                          Functional Consequence:
                          missense
                          Allele Origin:
                          G(germline)/A(germline)
                          Clinical significance:
                          other
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          G=0.4661/2334
                          HGVS:
                          NC_000016.10:g.56982180G>A, NC_000016.9:g.57016092G>A, NG_008952.1:g.25258G>A, NM_000078.2:c.1264G>A, NM_001286085.1:c.1084G>A, NP_000069.2:p.Val422Ile, NP_001273014.1:p.Val362Ile, XM_005255776.1:c.1084G>A, XP_005255833.1:p.Val362Ile

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Search details

                          See more...

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Write to the Help Desk