Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Results: 1 to 20 of 2732

1.

rs13073 [Homo sapiens]
    CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
    Chromosome:
    7:94667457
    Gene:
    PEG10 (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.2344/1174
    HGVS:
    NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
    3.

    rs7810469 [Homo sapiens]
      GGAGCAAAATAAAAAACATAAAGGA[A/G]ATAGATGAATTAGTAAGCAAATCAG
      Chromosome:
      7:94668502
      Gene:
      PEG10 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      A=0.0901/451
      HGVS:
      NC_000007.13:g.94297814G>A, NC_000007.14:g.94668502G>A, NG_011340.1:g.17178G>A, NM_001040152.1:c.*3968G>A, NM_001172437.2:c.*2820G>A, NM_001172438.2:c.*3968G>A, NM_001184961.1:c.*2820G>A, NM_001184962.1:c.*3968G>A, NM_015068.3:c.*2820G>A
      4.

      rs13226637 [Homo sapiens]
        CTGCTCTTATTCTTGCATGTTTAAA[C/T]ACTTAAAATTTTTAGTATAATTTTT
        Chromosome:
        7:94667481
        Gene:
        PEG10 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1693/848
        HGVS:
        NC_000007.13:g.94296793C>T, NC_000007.14:g.94667481C>T, NG_011340.1:g.16157C>T, NM_001040152.1:c.*2947C>T, NM_001172437.2:c.*1799C>T, NM_001172438.2:c.*2947C>T, NM_001184961.1:c.*1799C>T, NM_001184962.1:c.*2947C>T, NM_015068.3:c.*1799C>T
        5.

        rs1136428 has merged into rs13073 [Homo sapiens]
          CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
          Chromosome:
          7:94667457
          Gene:
          PEG10 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          T=0.2344/1174
          HGVS:
          NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
          6.

          rs3199711 has merged into rs13073 [Homo sapiens]
            CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
            Chromosome:
            7:94667457
            Gene:
            PEG10 (GeneView)
            Functional Consequence:
            utr variant 3 prime
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            T=0.2344/1174
            HGVS:
            NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
            7.

            rs10342382 has merged into rs7810469 [Homo sapiens]
              GGAGCAAAATAAAAAACATAAAGGA[A/G]ATAGATGAATTAGTAAGCAAATCAG
              Chromosome:
              7:94668502
              Gene:
              PEG10 (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              A=0.0901/451
              HGVS:
              NC_000007.13:g.94297814G>A, NC_000007.14:g.94668502G>A, NG_011340.1:g.17178G>A, NM_001040152.1:c.*3968G>A, NM_001172437.2:c.*2820G>A, NM_001172438.2:c.*3968G>A, NM_001184961.1:c.*2820G>A, NM_001184962.1:c.*3968G>A, NM_015068.3:c.*2820G>A
              8.

              rs10350123 has merged into rs13073 [Homo sapiens]
                CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                Chromosome:
                7:94667457
                Gene:
                PEG10 (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.2344/1174
                HGVS:
                NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                9.

                rs10480614 has merged into rs13073 [Homo sapiens]
                  CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                  Chromosome:
                  7:94667457
                  Gene:
                  PEG10 (GeneView)
                  Functional Consequence:
                  utr variant 3 prime
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.2344/1174
                  HGVS:
                  NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                  10.

                  rs11549142 has merged into rs13073 [Homo sapiens]
                    CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                    Chromosome:
                    7:94667457
                    Gene:
                    PEG10 (GeneView)
                    Functional Consequence:
                    utr variant 3 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.2344/1174
                    HGVS:
                    NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                    11.

                    rs11567283 has merged into rs13073 [Homo sapiens]
                      CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                      Chromosome:
                      7:94667457
                      Gene:
                      PEG10 (GeneView)
                      Functional Consequence:
                      utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.2344/1174
                      HGVS:
                      NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                      12.

                      rs17480308 has merged into rs13073 [Homo sapiens]
                        CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                        Chromosome:
                        7:94667457
                        Gene:
                        PEG10 (GeneView)
                        Functional Consequence:
                        utr variant 3 prime
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.2344/1174
                        HGVS:
                        NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                        13.

                        rs57774855 has merged into rs13226637 [Homo sapiens]
                          CTGCTCTTATTCTTGCATGTTTAAA[C/T]ACTTAAAATTTTTAGTATAATTTTT
                          Chromosome:
                          7:94667481
                          Gene:
                          PEG10 (GeneView)
                          Functional Consequence:
                          utr variant 3 prime
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1693/848
                          HGVS:
                          NC_000007.13:g.94296793C>T, NC_000007.14:g.94667481C>T, NG_011340.1:g.16157C>T, NM_001040152.1:c.*2947C>T, NM_001172437.2:c.*1799C>T, NM_001172438.2:c.*2947C>T, NM_001184961.1:c.*1799C>T, NM_001184962.1:c.*2947C>T, NM_015068.3:c.*1799C>T
                          14.

                          rs58015881 has merged into rs13073 [Homo sapiens]
                            CATCTTTCACATGTTCATTATCATC[C/T]GCTCTTATTCTTGCATGTTTAAACA
                            Chromosome:
                            7:94667457
                            Gene:
                            PEG10 (GeneView)
                            Functional Consequence:
                            utr variant 3 prime
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            T=0.2344/1174
                            HGVS:
                            NC_000007.13:g.94296769T>C, NC_000007.14:g.94667457T>C, NG_011340.1:g.16133T>C, NM_001040152.1:c.*2923T>C, NM_001172437.2:c.*1775T>C, NM_001172438.2:c.*2923T>C, NM_001184961.1:c.*1775T>C, NM_001184962.1:c.*2923T>C, NM_015068.3:c.*1775T>C
                            16.

                            rs14444 [Homo sapiens]
                              CGACTACTGATTTGCTTACTAATTC[A/T]TCTATCTCCTTTATGTTTTTTATTT
                              Chromosome:
                              7:94668508
                              Gene:
                              PEG10 (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Validated:
                              no info
                              HGVS:
                              NC_000007.13:g.94297820T>A, NC_000007.14:g.94668508T>A, NG_011340.1:g.17184T>A, NM_001040152.1:c.*3974T>A, NM_001172437.2:c.*2826T>A, NM_001172438.2:c.*3974T>A, NM_001184961.1:c.*2826T>A, NM_001184962.1:c.*3974T>A, NM_015068.3:c.*2826T>A
                              17.

                              rs1059044 [Homo sapiens]
                                AAAATTGCATTGCTTTTATTTCTTT[G/T]TGTAATCAAGTTTAAGTAATAGGGG
                                Chromosome:
                                7:94669125
                                Gene:
                                PEG10 (GeneView)
                                Functional Consequence:
                                utr variant 3 prime
                                Validated:
                                no info
                                HGVS:
                                NC_000007.13:g.94298437G>T, NC_000007.14:g.94669125G>T, NG_011340.1:g.17801G>T, NM_001040152.1:c.*4591G>T, NM_001172437.2:c.*3443G>T, NM_001172438.2:c.*4591G>T, NM_001184961.1:c.*3443G>T, NM_001184962.1:c.*4591G>T, NM_015068.3:c.*3443G>T
                                18.

                                rs1059224 [Homo sapiens]
                                  AAATTTATGTTAATTGGATCCTTTA[A/G]ATTTTTTTTGGCATTTTCCAACAAA
                                  Chromosome:
                                  7:94668387
                                  Gene:
                                  PEG10 (GeneView)
                                  Functional Consequence:
                                  utr variant 3 prime
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000007.13:g.94297699A>G, NC_000007.14:g.94668387A>G, NG_011340.1:g.17063A>G, NM_001040152.1:c.*3853A>G, NM_001172437.2:c.*2705A>G, NM_001172438.2:c.*3853A>G, NM_001184961.1:c.*2705A>G, NM_001184962.1:c.*3853A>G, NM_015068.3:c.*2705A>G
                                  19.

                                  rs1136429 [Homo sapiens]
                                    TGTTTAAACACTTAAAATTTTTAGT[A/G]TAATTTTTAGTGTGTTTTGAAGTGG
                                    Chromosome:
                                    7:94667498
                                    Gene:
                                    PEG10 (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000007.13:g.94296810A>G, NC_000007.14:g.94667498A>G, NG_011340.1:g.16174A>G, NM_001040152.1:c.*2964A>G, NM_001172437.2:c.*1816A>G, NM_001172438.2:c.*2964A>G, NM_001184961.1:c.*1816A>G, NM_001184962.1:c.*2964A>G, NM_015068.3:c.*1816A>G

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Search details

                                    See more...

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Write to the Help Desk