Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 585

1.

rs1474882 [Homo sapiens]
    TTTAATTTTTATATAAACTCTACAG[A/T]GAGATTATATATAATCTATATATAA
    Chromosome:
    6:144004992
    Gene:
    HYMAI (GeneView) PLAGL1 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2350/1177
    HGVS:
    NC_000006.11:g.144326129A>T, NC_000006.12:g.144004992A>T, NG_009384.1:g.64607T>A, NG_016174.1:g.8739T>A, NM_001080951.2:c.-615-19818T>A, NM_001080952.2:c.-590+3098T>A, NM_001080953.2:c.-544+3098T>A, NM_001080954.2:c.-543+3098T>A, NM_001080955.2:c.-237-36014T>A, NM_001080956.2:c.-238+3098T>A, NM_001289037.1:c.-196-36014T>A, NM_001289038.1:c.-150-36014T>A, NM_001289039.1:c.-236-36014T>A, NM_001289040.1:c.-222-19818T>A, NM_001289041.1:c.-238+3098T>A, NM_001289042.1:c.-428-36014T>A, NM_001289043.1:c.-551-19818T>A, NM_001289044.1:c.-502-36014T>A, NM_001289045.1:c.-852+3098T>A, NM_001289046.1:c.-833+3098T>A, NM_001289047.1:c.-397+3098T>A, NM_001289048.1:c.-558+3098T>A, NM_001289049.1:c.-503+3098T>A, NM_001317159.1:c.-542-19818T>A, NM_001317160.1:c.-224+3098T>A, NM_001317161.1:c.-558+3098T>A, NM_001317162.1:c.-584+3098T>A, NM_002656.3:c.-270+3098T>A, NM_006718.4:c.-576+3098T>A, NR_002768.2:n.3739T>A, XM_005267020.1:c.-671+3098T>A, XM_005267021.1:c.-558+3098T>A, XM_005267022.1:c.-503+3098T>A, XM_005267023.1:c.-256+3098T>A, XM_005267024.1:c.-224+3098T>A, XM_005267025.1:c.-183+3098T>A, XM_005267026.1:c.-236-36014T>A, XM_005267027.1:c.-238+3098T>A, XM_005267028.1:c.-264+3098T>A, XM_005267029.1:c.-222-19818T>A, XM_005267030.1:c.-223-36014T>A, XM_005267031.1:c.-236-19818T>A, XM_005267032.1:c.-231-19818T>A, XM_005267033.1:c.-108-36014T>A, XM_005267034.1:c.-108-36014T>A
    2.

    rs1884403 [Homo sapiens]
      GGCTTCCTAGCAATGAGAACATTTG[C/T]AATTGCTCTGCAACTTTATTTTTCC
      Chromosome:
      6:144009234
      Gene:
      HYMAI (GeneView) PLAGL1 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by frequency
      Global MAF:
      T=0.0016/8
      HGVS:
      NC_000006.11:g.144330371C>T, NC_000006.12:g.144009234C>T, NG_009384.1:g.60365G>A, NG_016174.1:g.4497G>A, NM_001080951.2:c.-615-24060G>A, NM_001080952.2:c.-1734G>A, NM_001080953.2:c.-1688G>A, NM_001080954.2:c.-1687G>A, NM_001080955.2:c.-237-40256G>A, NM_001080956.2:c.-1382G>A, NM_001289037.1:c.-196-40256G>A, NM_001289038.1:c.-150-40256G>A, NM_001289039.1:c.-236-40256G>A, NM_001289040.1:c.-222-24060G>A, NM_001289041.1:c.-1382G>A, NM_001289042.1:c.-428-40256G>A, NM_001289043.1:c.-551-24060G>A, NM_001289044.1:c.-502-40256G>A, NM_001289045.1:c.-1996G>A, NM_001289046.1:c.-1977G>A, NM_001289047.1:c.-1541G>A, NM_001289048.1:c.-1702G>A, NM_001289049.1:c.-1647G>A, NM_001317159.1:c.-542-24060G>A, NM_001317160.1:c.-1368G>A, NM_001317161.1:c.-1702G>A, NM_001317162.1:c.-1728G>A, NM_002656.3:c.-1414G>A, NM_006718.4:c.-1720G>A, NR_002768.2:n.-504G>A, XM_005267020.1:c.-1815G>A, XM_005267021.1:c.-1702G>A, XM_005267022.1:c.-1647G>A, XM_005267023.1:c.-1400G>A, XM_005267024.1:c.-1368G>A, XM_005267025.1:c.-1327G>A, XM_005267026.1:c.-236-40256G>A, XM_005267027.1:c.-1382G>A, XM_005267028.1:c.-1408G>A, XM_005267029.1:c.-222-24060G>A, XM_005267030.1:c.-223-40256G>A, XM_005267031.1:c.-236-24060G>A, XM_005267032.1:c.-231-24060G>A, XM_005267033.1:c.-108-40256G>A, XM_005267034.1:c.-108-40256G>A
      3.

      rs2281476 [Homo sapiens]
        GTAAGAATCGGGTCTGTGGACCTCA[C/T]ACCAGATAGGCGCGAACGCCTCTGG
        Chromosome:
        6:144007831
        Gene:
        HYMAI (GeneView) PLAGL1 (GeneView)
        Functional Consequence:
        intron variant,nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2057/1030
        HGVS:
        NC_000006.11:g.144328968T>C, NC_000006.12:g.144007831T>C, NG_009384.1:g.61768A>G, NG_016174.1:g.5900A>G, NM_001080951.2:c.-615-22657A>G, NM_001080952.2:c.-590+259A>G, NM_001080953.2:c.-544+259A>G, NM_001080954.2:c.-543+259A>G, NM_001080955.2:c.-237-38853A>G, NM_001080956.2:c.-238+259A>G, NM_001289037.1:c.-196-38853A>G, NM_001289038.1:c.-150-38853A>G, NM_001289039.1:c.-236-38853A>G, NM_001289040.1:c.-222-22657A>G, NM_001289041.1:c.-238+259A>G, NM_001289042.1:c.-428-38853A>G, NM_001289043.1:c.-551-22657A>G, NM_001289044.1:c.-502-38853A>G, NM_001289045.1:c.-852+259A>G, NM_001289046.1:c.-833+259A>G, NM_001289047.1:c.-397+259A>G, NM_001289048.1:c.-558+259A>G, NM_001289049.1:c.-503+259A>G, NM_001317159.1:c.-542-22657A>G, NM_001317160.1:c.-224+259A>G, NM_001317161.1:c.-558+259A>G, NM_001317162.1:c.-584+259A>G, NM_002656.3:c.-270+259A>G, NM_006718.4:c.-576+259A>G, NR_002768.2:n.900A>G, XM_005267020.1:c.-671+259A>G, XM_005267021.1:c.-558+259A>G, XM_005267022.1:c.-503+259A>G, XM_005267023.1:c.-256+259A>G, XM_005267024.1:c.-224+259A>G, XM_005267025.1:c.-183+259A>G, XM_005267026.1:c.-236-38853A>G, XM_005267027.1:c.-238+259A>G, XM_005267028.1:c.-264+259A>G, XM_005267029.1:c.-222-22657A>G, XM_005267030.1:c.-223-38853A>G, XM_005267031.1:c.-236-22657A>G, XM_005267032.1:c.-231-22657A>G, XM_005267033.1:c.-108-38853A>G, XM_005267034.1:c.-108-38853A>G
        4.

        rs2328537 [Homo sapiens]
          AGAGGTCCCAGCCAGTGCAATAAGG[C/T]AAGAAAAGGCGAAAAAGAGAATAGA
          Chromosome:
          6:144002435
          Gene:
          HYMAI (GeneView) PLAGL1 (GeneView)
          Functional Consequence:
          downstream variant 500B,intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.3692/1849
          HGVS:
          NC_000006.11:g.144323572C>T, NC_000006.12:g.144002435C>T, NG_009384.1:g.67164G>A, NG_016174.1:g.11296G>A, NM_001080951.2:c.-615-17261G>A, NM_001080952.2:c.-590+5655G>A, NM_001080953.2:c.-544+5655G>A, NM_001080954.2:c.-543+5655G>A, NM_001080955.2:c.-237-33457G>A, NM_001080956.2:c.-238+5655G>A, NM_001289037.1:c.-196-33457G>A, NM_001289038.1:c.-150-33457G>A, NM_001289039.1:c.-236-33457G>A, NM_001289040.1:c.-222-17261G>A, NM_001289041.1:c.-238+5655G>A, NM_001289042.1:c.-428-33457G>A, NM_001289043.1:c.-551-17261G>A, NM_001289044.1:c.-502-33457G>A, NM_001289045.1:c.-852+5655G>A, NM_001289046.1:c.-833+5655G>A, NM_001289047.1:c.-397+5655G>A, NM_001289048.1:c.-558+5655G>A, NM_001289049.1:c.-503+5655G>A, NM_001317159.1:c.-542-17261G>A, NM_001317160.1:c.-224+5655G>A, NM_001317161.1:c.-558+5655G>A, NM_001317162.1:c.-584+5655G>A, NM_002656.3:c.-270+5655G>A, NM_006718.4:c.-576+5655G>A, NR_002768.1:n.5456G>A, XM_005267020.1:c.-671+5655G>A, XM_005267021.1:c.-558+5655G>A, XM_005267022.1:c.-503+5655G>A, XM_005267023.1:c.-256+5655G>A, XM_005267024.1:c.-224+5655G>A, XM_005267025.1:c.-183+5655G>A, XM_005267026.1:c.-236-33457G>A, XM_005267027.1:c.-238+5655G>A, XM_005267028.1:c.-264+5655G>A, XM_005267029.1:c.-222-17261G>A, XM_005267030.1:c.-223-33457G>A, XM_005267031.1:c.-236-17261G>A, XM_005267032.1:c.-231-17261G>A, XM_005267033.1:c.-108-33457G>A, XM_005267034.1:c.-108-33457G>A
          5.

          rs2328538 [Homo sapiens]
            ATAGAATTGTAAAGGCATATTTAAA[A/C]CATTTTTTTTCCAGATGGCATGACA
            Chromosome:
            6:144002481
            Gene:
            HYMAI (GeneView) PLAGL1 (GeneView)
            Functional Consequence:
            downstream variant 500B,intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            A=0.3690/1848
            HGVS:
            NC_000006.11:g.144323618C>A, NC_000006.12:g.144002481C>A, NG_009384.1:g.67118G>T, NG_016174.1:g.11250G>T, NM_001080951.2:c.-615-17307G>T, NM_001080952.2:c.-590+5609G>T, NM_001080953.2:c.-544+5609G>T, NM_001080954.2:c.-543+5609G>T, NM_001080955.2:c.-237-33503G>T, NM_001080956.2:c.-238+5609G>T, NM_001289037.1:c.-196-33503G>T, NM_001289038.1:c.-150-33503G>T, NM_001289039.1:c.-236-33503G>T, NM_001289040.1:c.-222-17307G>T, NM_001289041.1:c.-238+5609G>T, NM_001289042.1:c.-428-33503G>T, NM_001289043.1:c.-551-17307G>T, NM_001289044.1:c.-502-33503G>T, NM_001289045.1:c.-852+5609G>T, NM_001289046.1:c.-833+5609G>T, NM_001289047.1:c.-397+5609G>T, NM_001289048.1:c.-558+5609G>T, NM_001289049.1:c.-503+5609G>T, NM_001317159.1:c.-542-17307G>T, NM_001317160.1:c.-224+5609G>T, NM_001317161.1:c.-558+5609G>T, NM_001317162.1:c.-584+5609G>T, NM_002656.3:c.-270+5609G>T, NM_006718.4:c.-576+5609G>T, NR_002768.1:n.5410G>T, XM_005267020.1:c.-671+5609G>T, XM_005267021.1:c.-558+5609G>T, XM_005267022.1:c.-503+5609G>T, XM_005267023.1:c.-256+5609G>T, XM_005267024.1:c.-224+5609G>T, XM_005267025.1:c.-183+5609G>T, XM_005267026.1:c.-236-33503G>T, XM_005267027.1:c.-238+5609G>T, XM_005267028.1:c.-264+5609G>T, XM_005267029.1:c.-222-17307G>T, XM_005267030.1:c.-223-33503G>T, XM_005267031.1:c.-236-17307G>T, XM_005267032.1:c.-231-17307G>T, XM_005267033.1:c.-108-33503G>T, XM_005267034.1:c.-108-33503G>T
            6.

            rs2328539 [Homo sapiens]
              aaactccaccacttacaacagcatc[A/T]aaaaaacattaaatgtctagaaata
              Chromosome:
              6:144002692
              Gene:
              HYMAI (GeneView) PLAGL1 (GeneView)
              Functional Consequence:
              downstream variant 500B,intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3718/1862
              HGVS:
              NC_000006.11:g.144323829A>T, NC_000006.12:g.144002692A>T, NG_009384.1:g.66907T>A, NG_016174.1:g.11039T>A, NM_001080951.2:c.-615-17518T>A, NM_001080952.2:c.-590+5398T>A, NM_001080953.2:c.-544+5398T>A, NM_001080954.2:c.-543+5398T>A, NM_001080955.2:c.-237-33714T>A, NM_001080956.2:c.-238+5398T>A, NM_001289037.1:c.-196-33714T>A, NM_001289038.1:c.-150-33714T>A, NM_001289039.1:c.-236-33714T>A, NM_001289040.1:c.-222-17518T>A, NM_001289041.1:c.-238+5398T>A, NM_001289042.1:c.-428-33714T>A, NM_001289043.1:c.-551-17518T>A, NM_001289044.1:c.-502-33714T>A, NM_001289045.1:c.-852+5398T>A, NM_001289046.1:c.-833+5398T>A, NM_001289047.1:c.-397+5398T>A, NM_001289048.1:c.-558+5398T>A, NM_001289049.1:c.-503+5398T>A, NM_001317159.1:c.-542-17518T>A, NM_001317160.1:c.-224+5398T>A, NM_001317161.1:c.-558+5398T>A, NM_001317162.1:c.-584+5398T>A, NM_002656.3:c.-270+5398T>A, NM_006718.4:c.-576+5398T>A, NR_002768.1:n.5199T>A, XM_005267020.1:c.-671+5398T>A, XM_005267021.1:c.-558+5398T>A, XM_005267022.1:c.-503+5398T>A, XM_005267023.1:c.-256+5398T>A, XM_005267024.1:c.-224+5398T>A, XM_005267025.1:c.-183+5398T>A, XM_005267026.1:c.-236-33714T>A, XM_005267027.1:c.-238+5398T>A, XM_005267028.1:c.-264+5398T>A, XM_005267029.1:c.-222-17518T>A, XM_005267030.1:c.-223-33714T>A, XM_005267031.1:c.-236-17518T>A, XM_005267032.1:c.-231-17518T>A, XM_005267033.1:c.-108-33714T>A, XM_005267034.1:c.-108-33714T>A
              7.

              rs6918637 [Homo sapiens]
                ttctgttcctgtgttagtttgctga[C/G]aatgatggtttccagcttcatccat
                Chromosome:
                6:144009801
                Gene:
                HYMAI (GeneView) PLAGL1 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                no info
                HGVS:
                NC_000006.11:g.144330938G>C, NC_000006.12:g.144009801G>C, NG_009384.1:g.59798C>G, NG_016174.1:g.3930C>G, NM_001080951.2:c.-615-24627C>G, NM_001080952.2:c.-2301C>G, NM_001080953.2:c.-2255C>G, NM_001080954.2:c.-2254C>G, NM_001080955.2:c.-237-40823C>G, NM_001080956.2:c.-1949C>G, NM_001289037.1:c.-196-40823C>G, NM_001289038.1:c.-150-40823C>G, NM_001289039.1:c.-236-40823C>G, NM_001289040.1:c.-222-24627C>G, NM_001289041.1:c.-1949C>G, NM_001289042.1:c.-428-40823C>G, NM_001289043.1:c.-551-24627C>G, NM_001289044.1:c.-502-40823C>G, NM_001289045.1:c.-2563C>G, NM_001289046.1:c.-2544C>G, NM_001289047.1:c.-2108C>G, NM_001289048.1:c.-2269C>G, NM_001289049.1:c.-2214C>G, NM_001317159.1:c.-542-24627C>G, NM_001317160.1:c.-1935C>G, NM_001317161.1:c.-2269C>G, NM_001317162.1:c.-2295C>G, NM_002656.3:c.-1981C>G, NM_006718.4:c.-2287C>G, NR_002768.2:n.-1071C>G, XM_005267020.1:c.-2382C>G, XM_005267021.1:c.-2269C>G, XM_005267022.1:c.-2214C>G, XM_005267023.1:c.-1967C>G, XM_005267024.1:c.-1935C>G, XM_005267025.1:c.-1894C>G, XM_005267026.1:c.-236-40823C>G, XM_005267027.1:c.-1949C>G, XM_005267028.1:c.-1975C>G, XM_005267029.1:c.-222-24627C>G, XM_005267030.1:c.-223-40823C>G, XM_005267031.1:c.-236-24627C>G, XM_005267032.1:c.-231-24627C>G, XM_005267033.1:c.-108-40823C>G, XM_005267034.1:c.-108-40823C>G
                8.

                rs6936558 [Homo sapiens]
                  aatggcatgaacctgggaggcggag[C/T]ttgcagtgagccgaggtcgtgccac
                  Chromosome:
                  6:144003560
                  Gene:
                  HYMAI (GeneView) PLAGL1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2350/1177
                  HGVS:
                  NC_000006.11:g.144324697T>C, NC_000006.12:g.144003560T>C, NG_009384.1:g.66039A>G, NG_016174.1:g.10171A>G, NM_001080951.2:c.-615-18386A>G, NM_001080952.2:c.-590+4530A>G, NM_001080953.2:c.-544+4530A>G, NM_001080954.2:c.-543+4530A>G, NM_001080955.2:c.-237-34582A>G, NM_001080956.2:c.-238+4530A>G, NM_001289037.1:c.-196-34582A>G, NM_001289038.1:c.-150-34582A>G, NM_001289039.1:c.-236-34582A>G, NM_001289040.1:c.-222-18386A>G, NM_001289041.1:c.-238+4530A>G, NM_001289042.1:c.-428-34582A>G, NM_001289043.1:c.-551-18386A>G, NM_001289044.1:c.-502-34582A>G, NM_001289045.1:c.-852+4530A>G, NM_001289046.1:c.-833+4530A>G, NM_001289047.1:c.-397+4530A>G, NM_001289048.1:c.-558+4530A>G, NM_001289049.1:c.-503+4530A>G, NM_001317159.1:c.-542-18386A>G, NM_001317160.1:c.-224+4530A>G, NM_001317161.1:c.-558+4530A>G, NM_001317162.1:c.-584+4530A>G, NM_002656.3:c.-270+4530A>G, NM_006718.4:c.-576+4530A>G, NR_002768.1:n.4394-63A>G, XM_005267020.1:c.-671+4530A>G, XM_005267021.1:c.-558+4530A>G, XM_005267022.1:c.-503+4530A>G, XM_005267023.1:c.-256+4530A>G, XM_005267024.1:c.-224+4530A>G, XM_005267025.1:c.-183+4530A>G, XM_005267026.1:c.-236-34582A>G, XM_005267027.1:c.-238+4530A>G, XM_005267028.1:c.-264+4530A>G, XM_005267029.1:c.-222-18386A>G, XM_005267030.1:c.-223-34582A>G, XM_005267031.1:c.-236-18386A>G, XM_005267032.1:c.-231-18386A>G, XM_005267033.1:c.-108-34582A>G, XM_005267034.1:c.-108-34582A>G
                  10.

                  rs9484837 [Homo sapiens]
                    gcaatcccaatcaaaattctggtag[A/G]cttttttttttttttttaatggaca
                    Chromosome:
                    6:144002882
                    Gene:
                    HYMAI (GeneView) PLAGL1 (GeneView)
                    Functional Consequence:
                    downstream variant 500B,intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.2354/1179
                    HGVS:
                    NC_000006.11:g.144324019G>A, NC_000006.12:g.144002882G>A, NG_009384.1:g.66717C>T, NG_016174.1:g.10849C>T, NM_001080951.2:c.-615-17708C>T, NM_001080952.2:c.-590+5208C>T, NM_001080953.2:c.-544+5208C>T, NM_001080954.2:c.-543+5208C>T, NM_001080955.2:c.-237-33904C>T, NM_001080956.2:c.-238+5208C>T, NM_001289037.1:c.-196-33904C>T, NM_001289038.1:c.-150-33904C>T, NM_001289039.1:c.-236-33904C>T, NM_001289040.1:c.-222-17708C>T, NM_001289041.1:c.-238+5208C>T, NM_001289042.1:c.-428-33904C>T, NM_001289043.1:c.-551-17708C>T, NM_001289044.1:c.-502-33904C>T, NM_001289045.1:c.-852+5208C>T, NM_001289046.1:c.-833+5208C>T, NM_001289047.1:c.-397+5208C>T, NM_001289048.1:c.-558+5208C>T, NM_001289049.1:c.-503+5208C>T, NM_001317159.1:c.-542-17708C>T, NM_001317160.1:c.-224+5208C>T, NM_001317161.1:c.-558+5208C>T, NM_001317162.1:c.-584+5208C>T, NM_002656.3:c.-270+5208C>T, NM_006718.4:c.-576+5208C>T, NR_002768.1:n.5009C>T, XM_005267020.1:c.-671+5208C>T, XM_005267021.1:c.-558+5208C>T, XM_005267022.1:c.-503+5208C>T, XM_005267023.1:c.-256+5208C>T, XM_005267024.1:c.-224+5208C>T, XM_005267025.1:c.-183+5208C>T, XM_005267026.1:c.-236-33904C>T, XM_005267027.1:c.-238+5208C>T, XM_005267028.1:c.-264+5208C>T, XM_005267029.1:c.-222-17708C>T, XM_005267030.1:c.-223-33904C>T, XM_005267031.1:c.-236-17708C>T, XM_005267032.1:c.-231-17708C>T, XM_005267033.1:c.-108-33904C>T, XM_005267034.1:c.-108-33904C>T
                    11.

                    rs9496833 [Homo sapiens]
                      atcccagcactttgggaggccaagg[C/T]gggtggatcacgaggtcaggagatc
                      Chromosome:
                      6:144003395
                      Gene:
                      HYMAI (GeneView) PLAGL1 (GeneView)
                      Functional Consequence:
                      intron variant,nc transcript variant
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      T=0.0248/124
                      HGVS:
                      NC_000006.11:g.144324532C>T, NC_000006.12:g.144003395C>T, NG_009384.1:g.66204G>A, NG_016174.1:g.10336G>A, NM_001080951.2:c.-615-18221G>A, NM_001080952.2:c.-590+4695G>A, NM_001080953.2:c.-544+4695G>A, NM_001080954.2:c.-543+4695G>A, NM_001080955.2:c.-237-34417G>A, NM_001080956.2:c.-238+4695G>A, NM_001289037.1:c.-196-34417G>A, NM_001289038.1:c.-150-34417G>A, NM_001289039.1:c.-236-34417G>A, NM_001289040.1:c.-222-18221G>A, NM_001289041.1:c.-238+4695G>A, NM_001289042.1:c.-428-34417G>A, NM_001289043.1:c.-551-18221G>A, NM_001289044.1:c.-502-34417G>A, NM_001289045.1:c.-852+4695G>A, NM_001289046.1:c.-833+4695G>A, NM_001289047.1:c.-397+4695G>A, NM_001289048.1:c.-558+4695G>A, NM_001289049.1:c.-503+4695G>A, NM_001317159.1:c.-542-18221G>A, NM_001317160.1:c.-224+4695G>A, NM_001317161.1:c.-558+4695G>A, NM_001317162.1:c.-584+4695G>A, NM_002656.3:c.-270+4695G>A, NM_006718.4:c.-576+4695G>A, NR_002768.1:n.4496G>A, XM_005267020.1:c.-671+4695G>A, XM_005267021.1:c.-558+4695G>A, XM_005267022.1:c.-503+4695G>A, XM_005267023.1:c.-256+4695G>A, XM_005267024.1:c.-224+4695G>A, XM_005267025.1:c.-183+4695G>A, XM_005267026.1:c.-236-34417G>A, XM_005267027.1:c.-238+4695G>A, XM_005267028.1:c.-264+4695G>A, XM_005267029.1:c.-222-18221G>A, XM_005267030.1:c.-223-34417G>A, XM_005267031.1:c.-236-18221G>A, XM_005267032.1:c.-231-18221G>A, XM_005267033.1:c.-108-34417G>A, XM_005267034.1:c.-108-34417G>A
                      12.

                      rs9496835 [Homo sapiens]
                        caactactcaactctgccAAATGGG[A/G]ATAACTATGTTCCAGTAAttttttt
                        Chromosome:
                        6:144004166
                        Gene:
                        HYMAI (GeneView) PLAGL1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        A=0.0300/150
                        HGVS:
                        NC_000006.11:g.144325303G>A, NC_000006.12:g.144004166G>A, NG_009384.1:g.65433C>T, NG_016174.1:g.9565C>T, NM_001080951.2:c.-615-18992C>T, NM_001080952.2:c.-590+3924C>T, NM_001080953.2:c.-544+3924C>T, NM_001080954.2:c.-543+3924C>T, NM_001080955.2:c.-237-35188C>T, NM_001080956.2:c.-238+3924C>T, NM_001289037.1:c.-196-35188C>T, NM_001289038.1:c.-150-35188C>T, NM_001289039.1:c.-236-35188C>T, NM_001289040.1:c.-222-18992C>T, NM_001289041.1:c.-238+3924C>T, NM_001289042.1:c.-428-35188C>T, NM_001289043.1:c.-551-18992C>T, NM_001289044.1:c.-502-35188C>T, NM_001289045.1:c.-852+3924C>T, NM_001289046.1:c.-833+3924C>T, NM_001289047.1:c.-397+3924C>T, NM_001289048.1:c.-558+3924C>T, NM_001289049.1:c.-503+3924C>T, NM_001317159.1:c.-542-18992C>T, NM_001317160.1:c.-224+3924C>T, NM_001317161.1:c.-558+3924C>T, NM_001317162.1:c.-584+3924C>T, NM_002656.3:c.-270+3924C>T, NM_006718.4:c.-576+3924C>T, NR_002768.1:n.4393+172C>T, XM_005267020.1:c.-671+3924C>T, XM_005267021.1:c.-558+3924C>T, XM_005267022.1:c.-503+3924C>T, XM_005267023.1:c.-256+3924C>T, XM_005267024.1:c.-224+3924C>T, XM_005267025.1:c.-183+3924C>T, XM_005267026.1:c.-236-35188C>T, XM_005267027.1:c.-238+3924C>T, XM_005267028.1:c.-264+3924C>T, XM_005267029.1:c.-222-18992C>T, XM_005267030.1:c.-223-35188C>T, XM_005267031.1:c.-236-18992C>T, XM_005267032.1:c.-231-18992C>T, XM_005267033.1:c.-108-35188C>T, XM_005267034.1:c.-108-35188C>T
                        14.

                        rs11155339 [Homo sapiens]
                          AGGCTTCTTCAGTTTGCAACACCCA[C/T]ATTTTAACATATTTGGGGGGAAATG
                          Chromosome:
                          6:144006291
                          Gene:
                          HYMAI (GeneView) PLAGL1 (GeneView)
                          Functional Consequence:
                          intron variant,nc transcript variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.1929/966
                          HGVS:
                          NC_000006.11:g.144327428T>C, NC_000006.12:g.144006291T>C, NG_009384.1:g.63308A>G, NG_016174.1:g.7440A>G, NM_001080951.2:c.-615-21117A>G, NM_001080952.2:c.-590+1799A>G, NM_001080953.2:c.-544+1799A>G, NM_001080954.2:c.-543+1799A>G, NM_001080955.2:c.-237-37313A>G, NM_001080956.2:c.-238+1799A>G, NM_001289037.1:c.-196-37313A>G, NM_001289038.1:c.-150-37313A>G, NM_001289039.1:c.-236-37313A>G, NM_001289040.1:c.-222-21117A>G, NM_001289041.1:c.-238+1799A>G, NM_001289042.1:c.-428-37313A>G, NM_001289043.1:c.-551-21117A>G, NM_001289044.1:c.-502-37313A>G, NM_001289045.1:c.-852+1799A>G, NM_001289046.1:c.-833+1799A>G, NM_001289047.1:c.-397+1799A>G, NM_001289048.1:c.-558+1799A>G, NM_001289049.1:c.-503+1799A>G, NM_001317159.1:c.-542-21117A>G, NM_001317160.1:c.-224+1799A>G, NM_001317161.1:c.-558+1799A>G, NM_001317162.1:c.-584+1799A>G, NM_002656.3:c.-270+1799A>G, NM_006718.4:c.-576+1799A>G, NR_002768.2:n.2440A>G, XM_005267020.1:c.-671+1799A>G, XM_005267021.1:c.-558+1799A>G, XM_005267022.1:c.-503+1799A>G, XM_005267023.1:c.-256+1799A>G, XM_005267024.1:c.-224+1799A>G, XM_005267025.1:c.-183+1799A>G, XM_005267026.1:c.-236-37313A>G, XM_005267027.1:c.-238+1799A>G, XM_005267028.1:c.-264+1799A>G, XM_005267029.1:c.-222-21117A>G, XM_005267030.1:c.-223-37313A>G, XM_005267031.1:c.-236-21117A>G, XM_005267032.1:c.-231-21117A>G, XM_005267033.1:c.-108-37313A>G, XM_005267034.1:c.-108-37313A>G
                          15.

                          rs11759634 [Homo sapiens]
                            cttaatccagtctatcaccaatggc[C/T]atttgggttgattccaagtctttgc
                            Chromosome:
                            6:144009926
                            Gene:
                            HYMAI (GeneView) PLAGL1 (GeneView)
                            Functional Consequence:
                            intron variant,upstream variant 2KB
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.1625/814
                            HGVS:
                            NC_000006.11:g.144331063C>T, NC_000006.12:g.144009926C>T, NG_009384.1:g.59673G>A, NG_016174.1:g.3805G>A, NM_001080951.2:c.-615-24752G>A, NM_001080952.2:c.-2426G>A, NM_001080953.2:c.-2380G>A, NM_001080954.2:c.-2379G>A, NM_001080955.2:c.-237-40948G>A, NM_001080956.2:c.-2074G>A, NM_001289037.1:c.-196-40948G>A, NM_001289038.1:c.-150-40948G>A, NM_001289039.1:c.-236-40948G>A, NM_001289040.1:c.-222-24752G>A, NM_001289041.1:c.-2074G>A, NM_001289042.1:c.-428-40948G>A, NM_001289043.1:c.-551-24752G>A, NM_001289044.1:c.-502-40948G>A, NM_001289045.1:c.-2688G>A, NM_001289046.1:c.-2669G>A, NM_001289047.1:c.-2233G>A, NM_001289048.1:c.-2394G>A, NM_001289049.1:c.-2339G>A, NM_001317159.1:c.-542-24752G>A, NM_001317160.1:c.-2060G>A, NM_001317161.1:c.-2394G>A, NM_001317162.1:c.-2420G>A, NM_002656.3:c.-2106G>A, NM_006718.4:c.-2412G>A, NR_002768.2:n.-1196G>A, XM_005267020.1:c.-2507G>A, XM_005267021.1:c.-2394G>A, XM_005267022.1:c.-2339G>A, XM_005267023.1:c.-2092G>A, XM_005267024.1:c.-2060G>A, XM_005267025.1:c.-2019G>A, XM_005267026.1:c.-236-40948G>A, XM_005267027.1:c.-2074G>A, XM_005267028.1:c.-2100G>A, XM_005267029.1:c.-222-24752G>A, XM_005267030.1:c.-223-40948G>A, XM_005267031.1:c.-236-24752G>A, XM_005267032.1:c.-231-24752G>A, XM_005267033.1:c.-108-40948G>A, XM_005267034.1:c.-108-40948G>A
                            17.

                            rs12208752 [Homo sapiens]
                              aactttttttttttttggttcaaca[C/T]tGAAAGGCATTTGTGTTGAAACACA
                              Chromosome:
                              6:144006598
                              Gene:
                              HYMAI (GeneView) PLAGL1 (GeneView)
                              Functional Consequence:
                              intron variant,nc transcript variant
                              Validated:
                              no info
                              HGVS:
                              NC_000006.11:g.144327735C>T, NC_000006.12:g.144006598C>T, NG_009384.1:g.63001G>A, NG_016174.1:g.7133G>A, NM_001080951.2:c.-615-21424G>A, NM_001080952.2:c.-590+1492G>A, NM_001080953.2:c.-544+1492G>A, NM_001080954.2:c.-543+1492G>A, NM_001080955.2:c.-237-37620G>A, NM_001080956.2:c.-238+1492G>A, NM_001289037.1:c.-196-37620G>A, NM_001289038.1:c.-150-37620G>A, NM_001289039.1:c.-236-37620G>A, NM_001289040.1:c.-222-21424G>A, NM_001289041.1:c.-238+1492G>A, NM_001289042.1:c.-428-37620G>A, NM_001289043.1:c.-551-21424G>A, NM_001289044.1:c.-502-37620G>A, NM_001289045.1:c.-852+1492G>A, NM_001289046.1:c.-833+1492G>A, NM_001289047.1:c.-397+1492G>A, NM_001289048.1:c.-558+1492G>A, NM_001289049.1:c.-503+1492G>A, NM_001317159.1:c.-542-21424G>A, NM_001317160.1:c.-224+1492G>A, NM_001317161.1:c.-558+1492G>A, NM_001317162.1:c.-584+1492G>A, NM_002656.3:c.-270+1492G>A, NM_006718.4:c.-576+1492G>A, NR_002768.2:n.2133G>A, XM_005267020.1:c.-671+1492G>A, XM_005267021.1:c.-558+1492G>A, XM_005267022.1:c.-503+1492G>A, XM_005267023.1:c.-256+1492G>A, XM_005267024.1:c.-224+1492G>A, XM_005267025.1:c.-183+1492G>A, XM_005267026.1:c.-236-37620G>A, XM_005267027.1:c.-238+1492G>A, XM_005267028.1:c.-264+1492G>A, XM_005267029.1:c.-222-21424G>A, XM_005267030.1:c.-223-37620G>A, XM_005267031.1:c.-236-21424G>A, XM_005267032.1:c.-231-21424G>A, XM_005267033.1:c.-108-37620G>A, XM_005267034.1:c.-108-37620G>A
                              18.

                              rs12524155 [Homo sapiens]
                                CAAAACTTTCCTGAATTAATGAAAC[A/G]TAAACCTTAGAGACAGGAGATTTTA
                                Chromosome:
                                6:144004909
                                Gene:
                                HYMAI (GeneView) PLAGL1 (GeneView)
                                Functional Consequence:
                                downstream variant 500B,intron variant,nc transcript variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.1927/965
                                HGVS:
                                NC_000006.11:g.144326046A>G, NC_000006.12:g.144004909A>G, NG_009384.1:g.64690T>C, NG_016174.1:g.8822T>C, NM_001080951.2:c.-615-19735T>C, NM_001080952.2:c.-590+3181T>C, NM_001080953.2:c.-544+3181T>C, NM_001080954.2:c.-543+3181T>C, NM_001080955.2:c.-237-35931T>C, NM_001080956.2:c.-238+3181T>C, NM_001289037.1:c.-196-35931T>C, NM_001289038.1:c.-150-35931T>C, NM_001289039.1:c.-236-35931T>C, NM_001289040.1:c.-222-19735T>C, NM_001289041.1:c.-238+3181T>C, NM_001289042.1:c.-428-35931T>C, NM_001289043.1:c.-551-19735T>C, NM_001289044.1:c.-502-35931T>C, NM_001289045.1:c.-852+3181T>C, NM_001289046.1:c.-833+3181T>C, NM_001289047.1:c.-397+3181T>C, NM_001289048.1:c.-558+3181T>C, NM_001289049.1:c.-503+3181T>C, NM_001317159.1:c.-542-19735T>C, NM_001317160.1:c.-224+3181T>C, NM_001317161.1:c.-558+3181T>C, NM_001317162.1:c.-584+3181T>C, NM_002656.3:c.-270+3181T>C, NM_006718.4:c.-576+3181T>C, NR_002768.1:n.3822T>C, NR_002768.2:n.3822T>C, XM_005267020.1:c.-671+3181T>C, XM_005267021.1:c.-558+3181T>C, XM_005267022.1:c.-503+3181T>C, XM_005267023.1:c.-256+3181T>C, XM_005267024.1:c.-224+3181T>C, XM_005267025.1:c.-183+3181T>C, XM_005267026.1:c.-236-35931T>C, XM_005267027.1:c.-238+3181T>C, XM_005267028.1:c.-264+3181T>C, XM_005267029.1:c.-222-19735T>C, XM_005267030.1:c.-223-35931T>C, XM_005267031.1:c.-236-19735T>C, XM_005267032.1:c.-231-19735T>C, XM_005267033.1:c.-108-35931T>C, XM_005267034.1:c.-108-35931T>C
                                19.

                                rs12529147 [Homo sapiens]
                                  aatctgcatactgccaaaactataa[A/G]tgaatttagcaagcgcacaaaatac
                                  Chromosome:
                                  6:144002564
                                  Gene:
                                  HYMAI (GeneView) PLAGL1 (GeneView)
                                  Functional Consequence:
                                  downstream variant 500B,intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.1532/767
                                  HGVS:
                                  NC_000006.11:g.144323701G>A, NC_000006.12:g.144002564G>A, NG_009384.1:g.67035C>T, NG_016174.1:g.11167C>T, NM_001080951.2:c.-615-17390C>T, NM_001080952.2:c.-590+5526C>T, NM_001080953.2:c.-544+5526C>T, NM_001080954.2:c.-543+5526C>T, NM_001080955.2:c.-237-33586C>T, NM_001080956.2:c.-238+5526C>T, NM_001289037.1:c.-196-33586C>T, NM_001289038.1:c.-150-33586C>T, NM_001289039.1:c.-236-33586C>T, NM_001289040.1:c.-222-17390C>T, NM_001289041.1:c.-238+5526C>T, NM_001289042.1:c.-428-33586C>T, NM_001289043.1:c.-551-17390C>T, NM_001289044.1:c.-502-33586C>T, NM_001289045.1:c.-852+5526C>T, NM_001289046.1:c.-833+5526C>T, NM_001289047.1:c.-397+5526C>T, NM_001289048.1:c.-558+5526C>T, NM_001289049.1:c.-503+5526C>T, NM_001317159.1:c.-542-17390C>T, NM_001317160.1:c.-224+5526C>T, NM_001317161.1:c.-558+5526C>T, NM_001317162.1:c.-584+5526C>T, NM_002656.3:c.-270+5526C>T, NM_006718.4:c.-576+5526C>T, NR_002768.1:n.5327C>T, XM_005267020.1:c.-671+5526C>T, XM_005267021.1:c.-558+5526C>T, XM_005267022.1:c.-503+5526C>T, XM_005267023.1:c.-256+5526C>T, XM_005267024.1:c.-224+5526C>T, XM_005267025.1:c.-183+5526C>T, XM_005267026.1:c.-236-33586C>T, XM_005267027.1:c.-238+5526C>T, XM_005267028.1:c.-264+5526C>T, XM_005267029.1:c.-222-17390C>T, XM_005267030.1:c.-223-33586C>T, XM_005267031.1:c.-236-17390C>T, XM_005267032.1:c.-231-17390C>T, XM_005267033.1:c.-108-33586C>T, XM_005267034.1:c.-108-33586C>T
                                  20.

                                  rs12529648 [Homo sapiens]
                                    tcaataggcaggtgataaaggaaat[C/G]taaatagctgattaagatattttaa
                                    Chromosome:
                                    6:144003803
                                    Gene:
                                    HYMAI (GeneView) PLAGL1 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by hapmap
                                    HGVS:
                                    NC_000006.11:g.144324940C>G, NC_000006.12:g.144003803C>G, NG_009384.1:g.65796G>C, NG_016174.1:g.9928G>C, NM_001080951.2:c.-615-18629G>C, NM_001080952.2:c.-590+4287G>C, NM_001080953.2:c.-544+4287G>C, NM_001080954.2:c.-543+4287G>C, NM_001080955.2:c.-237-34825G>C, NM_001080956.2:c.-238+4287G>C, NM_001289037.1:c.-196-34825G>C, NM_001289038.1:c.-150-34825G>C, NM_001289039.1:c.-236-34825G>C, NM_001289040.1:c.-222-18629G>C, NM_001289041.1:c.-238+4287G>C, NM_001289042.1:c.-428-34825G>C, NM_001289043.1:c.-551-18629G>C, NM_001289044.1:c.-502-34825G>C, NM_001289045.1:c.-852+4287G>C, NM_001289046.1:c.-833+4287G>C, NM_001289047.1:c.-397+4287G>C, NM_001289048.1:c.-558+4287G>C, NM_001289049.1:c.-503+4287G>C, NM_001317159.1:c.-542-18629G>C, NM_001317160.1:c.-224+4287G>C, NM_001317161.1:c.-558+4287G>C, NM_001317162.1:c.-584+4287G>C, NM_002656.3:c.-270+4287G>C, NM_006718.4:c.-576+4287G>C, NR_002768.1:n.4394-306G>C, XM_005267020.1:c.-671+4287G>C, XM_005267021.1:c.-558+4287G>C, XM_005267022.1:c.-503+4287G>C, XM_005267023.1:c.-256+4287G>C, XM_005267024.1:c.-224+4287G>C, XM_005267025.1:c.-183+4287G>C, XM_005267026.1:c.-236-34825G>C, XM_005267027.1:c.-238+4287G>C, XM_005267028.1:c.-264+4287G>C, XM_005267029.1:c.-222-18629G>C, XM_005267030.1:c.-223-34825G>C, XM_005267031.1:c.-236-18629G>C, XM_005267032.1:c.-231-18629G>C, XM_005267033.1:c.-108-34825G>C, XM_005267034.1:c.-108-34825G>C

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Search details

                                    See more...

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center