Display Settings:

Format

Send to:

Choose Destination
1.

rs33930476 has merged into rs281864894 [Homo sapiens]
    TGAGTCCTTTGGGGATCTGTCCACT[C/T]CTGATGCTGTTATGGGCAACCCTAA
    Chromosome:
    11:5226738
    Gene:
    HBB (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    by cluster
    HGVS:
    NC_000011.10:g.5226738G>A, NC_000011.9:g.5247968G>A, NG_000007.3:g.70878C>T, NM_000518.4:c.154C>T, NP_000509.1:p.Pro52Ser

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk