Display Settings:

Format

Send to:

Choose Destination
1.

rs281863517 has merged into rs117133560 [Homo sapiens]
    TGAGCCATCATCCGGAAGGAATCAT[A/G]GTTTCTGCTTGGACTTGAACTTTTC
    Chromosome:
    6:32663092
    Gene:
    HLA-DQB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    HGVS:
    NC_000006.11:g.32630869G>A, NC_000006.12:g.32663092G>A, NG_029922.1:g.8999C>T, NM_001243961.1:c.380-787C>T, NM_001243961.1:c.380-844C>T, NM_001243962.1:c.380-787C>T, NM_002123.4:c.380-787C>T, NM_002123.4:c.380-844C>T, NT_113891.3:g.4076007G>A, NT_167245.2:g.3903902G>A, NT_167246.2:g.4080516G>A, NT_167247.1:g.?G>A, NT_167247.2:g.3959450G>A, NT_167248.2:g.3856971G>A, NT_167249.2:g.4060305G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk