Display Settings:

Format

Send to:

Choose Destination
1.

rs276174810 [Homo sapiens]
    TGATCCAAACTTTAAAAAAGAAACT[A/G]AAGCCTCTGAAAGTGGACTGGAAAT
    Chromosome:
    13:32333078
    Gene:
    BRCA2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Uncertain significance
    Validated:
    by 1000G,by cluster
    Global MAF:
    A=0.0002/1
    HGVS:
    AAB07223.1:p.Glu534Lys, NC_000013.10:g.32907215G>A, NC_000013.11:g.32333078G>A, NG_012772.3:g.22599G>A, NM_000059.3:c.1600G>A, NP_000050.2:p.Glu534Lys, U43746.1:c.1600G>A, XM_011535203.1:c.1600G>A, XM_011535204.1:c.1600G>A, XM_011535205.1:c.1600G>A, XP_011533505.1:p.Glu534Lys, XP_011533506.1:p.Glu534Lys, XP_011533507.1:p.Glu534Lys

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk