Display Settings:

Format

Send to:

Choose Destination
1.

rs199878974 [Homo sapiens]
    TGGTATTATGATAGTGATGATGGTG[A/G]TGGTGGTGATGGTGATGATGGTGGT
    Chromosome:
    Y:11048750
    Allele Origin:
    G(somatic)/A(germline,somatic)
    Validated:
    by cluster
    HGVS:
    NC_000024.10:g.11048750A>G, NC_000024.9:g.13204426A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk