Display Settings:

Format

Send to:

Choose Destination
1.

rs193922096 [Homo sapiens]
    AGGCCGTGGCCCCAGCGCATGTGCC[A/C/G]GCACCTAGCCCGCAAGGCCCTGGTG
    Chromosome:
    X:153743687
    Gene:
    ABCD1 (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Likely benign
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000023.10:g.153009141G>A, NC_000023.11:g.153743687G>A, NG_009022.2:g.23820G>A, NM_000033.3:c.2190G>A, NP_000024.2:p.Pro730, NW_003871103.3:g.1177669G>A, XR_938507.1:n.2662G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Write to the Help Desk