GEO Profiles for Gene (Select 107581) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1266

<< First< Prev

Page of 64

Next >Last >>

Select item 273940861.

Col16a1 - Runt-related transcription factor 2 null mutation effect on the embryonal bone (MG-U74B)

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL82, 162976_at (ID_REF), GDS2185, 107581 (Gene ID), AI838662

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27394086

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270699502.

Col16a1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL4134, 36750 (ID_REF), GDS5461, NM_028266, A_51_P291062 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127069950

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303817503.

Col16a1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL4134, 36750 (ID_REF), GDS5664, NM_028266, A_51_P291062 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130381750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278786514.

Col16a1 - White adipose tissue development

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1248099 (ID_REF), GDS5528, NM_028266

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 127878651

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1277187555.

Col16a1 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1248099 (ID_REF), GDS5520, NM_028266, COL16A1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127718755

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1114247516.

Col16a1 - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1248099 (ID_REF), GDS5066, NM_028266

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111424751

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 545476927.

Col16a1 - Transcription factor paired box 3 knockin embryos: palate

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1427986_a_at (ID_REF), GDS3331, 107581 (Gene ID), BB766878

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 54547692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 169729868.

Col16a1 - Osteoblast differentiation (MG-U74B)

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL82, 162976_at (ID_REF), GDS1632, 107581 (Gene ID), AI838662

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16972986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76211729.

Col16a1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGGCCCCCGGGTC (ID_REF), GDS878, BC023940

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7621172

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 478118610.

Col16a1 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL82, 162976_at (ID_REF), GDS606, 107581 (Gene ID), AI838662

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4781186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13172315511.

Col16a1 - αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1248099 (ID_REF), GDS5820, NM_028266, COL16A1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131723155

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12965029212.

Col16a1 - Tendon development: embryonic limb tendon cells

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1427986_a_at (ID_REF), GDS5642, 107581 (Gene ID), BB766878

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129650292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12483315113.

Col16a1 - DPP4A overexpression effect on fibroblast cell line

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1248099 (ID_REF), GDS5400, NM_028266

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124833151

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7461765514.

Col16a1 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1248099 (ID_REF), GDS3974, NM_028266, COL16A1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74617655

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13176985515.

Col16a1 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1248099 (ID_REF), GDS5821, NM_028266, COL16A1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131769855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11098119216.

Col16a1 - Histone demethylase KDM1A deficiency effect on 3T3-L1 preadipocytes: time course

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1261, 1427986_a_at (ID_REF), GDS5055, 107581 (Gene ID), BB766878

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 110981192

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3220901817.

Col16a1 - Fibroblast growth factor 2 effect on embryonic fibroblast: dose response

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL4055, scl24899.72.1_88-S (ID_REF), GDS2421, NM_028266

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 32209018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1838721418.

Col16a1 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1226, 10614 (ID_REF), GDS1705, AK012212

DataSet type:: Expression profiling by array, log2 ratio, 16 samples

ID:: 18387214

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748347219.

Col16a1 - MPSS transcriptome analysis project

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGGCCCCCGGGTC (ID_REF), GDS868, BC023940

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483472

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596526020.

Col16a1 - High fat diet effect on aorta: time course

Annotation:: Col16a1, collagen, type XVI, alpha 1

Organism:: Mus musculus

Reporter:: GPL891, 15960 (ID_REF), GDS735, NM_028266, A_51_P291062 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5965260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 64

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles for Gene (Select 107581) (1266)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1266

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity