Pedigree of a CEPH family whose parents are heterozygous for the stop mutation. Open symbols represent C/C homozygous individuals; filled symbols represent T/T homozygous individuals, and mixed symbols represent C/T heterozygous individuals. Squares, males; circles, females.

(A) Expected Bsp1286I restriction map of the ERV-3 S3-AS3 amplimer and restriction analysis of a series of 13 individuals. The arrows indicate the restriction fragments obtained after electrophoresis in a 2% agarose gel. Molecular size markers are shown on the right. (B) Nucleotide sequence analysis of PCR-amplified genomic fragments from three individuals for the polymorphism at nucleotide 1354. Lane numbers refer to those in A. (C) Direct in vitro transcription-translation assay for ERV-3 envelope gene products from the three individuals in B. The arrows indicate the translational products after migration in a 14% polyacrylamide gel. The two ERV-3 envelope proteins obtained are represented, and the SU, the TM, the FP (fusion peptide), and the ISU (immunosuppressive domain) are indicated. SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Identification of polymorphic sites within the sequences of ERV-3 envelope genes from five unrelated individuals. The ERV-3 provirus with the envelope open reading frame (open rectangle) and its expected functional domains, including the proteolytic cleavage site, the fusion peptide, and the immunosuppressive domain, are schematically represented at the top. The putative hydrophobic domain is shown in a dotted rectangle as an extension of the open reading frame if the stop codon at nucleotide 2500 is read through. The G insertion at position 796 (see Table 1) leads to an upstream shift in the frame, unlike that of the previously published ERV-3 sequence, and introduces a potential signal peptide and four new Met codons (represented by short vertical lines). LTR, long terminal repeat; SD, splice donor site; SA, splice acceptor site. The primers used in this study are indicated, and 5′-3′ sequences are given for S2 (CGGCCGAAGCTTGAGTCATCATCAGGG), T7atg (GCTAATACGACTCACTATAGGAACAGACCACCatgACTAAAACCCTGTTGTATCA), S3 (AACCAACAATCACTAGGGCC), AS3 (TGCCCCTCCATAAAGTCTTTCCTAG), and AS (GTTAATACTTAGTTAGGGCC). At the bottom, the envelope gene sequences of five individuals and the corresponding polymorphic sites within the ERV-3 consensus sequence are represented; both alleles for each site are indicated. Numbers refer to the ERV-3 pol-env published sequence (4; accession no. M12140).