Changes in miRNA profile after transfection of HeLa cells with HIV-1 pNL4-3. A) Example slide readouts are shown using small RNAs isolated from mock-(left panel) and pNL4-3-transfected HeLa cells (right panel). Here, each probe was printed 5 times in a row (spots 1, 2, 3, 4 and 5 labeled at top of the arrays). Signals appear as green dots. B) Cell plot analysis of the miRNA expression profiles of mock-transfected HeLa cells (samples 1 and 2) and pNL4-3-transfected HeLa cells (sample 3). Each colored block represents the expression of one miRNA (labeled on the left) in the indicated sample. Signals acquired from the microarray are converted into color (high signal = red; low signal = black; no signal = green). Samples 1 and 2 (mock-transfected HeLa cells) show highly similar color patterns while sample 3 (pNL4-3-transfected HeLa cells) shows reduced miRNA expression (i.e. only a few blocks appear red in color). The red-boxed miRNAs were chosen for real-time PCR validation in figure 5.

Schematic diagram of the RAKE assay. A) The DNA oligonucleotide probe for miRNA detection is composed of three elements. The 5' linker region contains a constant nucleotide sequence (5'GTCGTGACTGGGAATAGCCTG3') with an amine-modified 5'end which permits the probe to conjugate efficiently to the epoxy-coated microarray glass slide. The anti-miRNA region contains a sequence complementary to specific miRNA (for instance, anti-hsa-let-7a 5'AACTATACAACCTACTACCTCA3') for capturing the cognate miRNA (hsa-let-7a 5'UGAGGUAGUAGGUUGUAUAGUU3'). The poly-thymidine region acts as a template for primer extension of the hybridized miRNA using biotinylated-dATP. B) Small RNAs isolated from cells are hybridized to the microarray slide described in A. After washing, unhybridized single-stranded DNA probes (ssDNA probes) are removed by exonuclease I. Digested nucleotides are then removed leaving the hybridized miRNAs for primer extension. The poly-thymidine region now acts as a template for the hybridized miRNA to be extended using Klenow (3'→5' exo^-) in the presence of biotinylated-dATP. Streptavidin-Alexa fluor 555 is then used to bind the biotin group permitting the fluorescent detection of hybridized miRNAs using a GenePix 4000B microarray scanner (Axon/Molecular Dynamics).

Validation of RAKE using real-time PCR. Fluorescence signals from each of the 45 PCR cycles were collected and converted into log₁₀ values. The log₁₀ fluorescence values (Y-axis) of each sample are then plotted against the PCR cycles (X-axis) to generate a sigmoid curve. C_T (threshold-cycle; dotted line) determines the minimum PCR cycle required for the reaction to give a threshold fluorescence signal. Samples with more templates require fewer PCR cycles to reach the threshold. Comparison of the miRNA expression levels in pNL4-3- (green curve) and mock-transfected HeLa cells (red curve) are facilitated by using cellular small nuclear U6 RNA (blue curve from mock, and orange curve from pNL4-3; please note that the blue and orange control curves superimpose closely on top of each other, supporting the validity of the PCR conditions for comparing the experimental curves) and an empirically established unchanged miRNA (mi-526c; mock and pNL4-3 samples are shown in red and in green curves, respectively) as normalization references (A). Selected pNL4-3-downregulated miRNAs [miR-93 (B), miR-148b (C), miR-221 (D) and miR-16 (E)] were validated by real-time PCR. Real-time PCR curves for U6 RNA control (mock and pNL4-3) are included in all of the graphs for normalization. Signals of the selected miRNAs measured in the RAKE assay from different samples (1, 2 and 3) are presented in table form at the top of each graph.

Scatterplot analysis of the changes in miRNA expression after transfection of HeLa cells with HIV-1 clone pNL4-3. Pairwise comparison of two mock-transfected HeLa cells (sample 1 vs. sample 2) to each other and to pNL4-3-transfected HeLa cells (sample 3) by scatterplot analysis. Spots associated with individual miRNAs were collected and converted into log₂ scale. Each datum point represents one unique probe sequence (based on median values from 4 replicated spots from each hybridization). miRNAs with similar signal intensities from the two samples being compared line up together on a 45° diagonal line (center line). This is most clearly seen in (A), where two mock-transfected HeLa cells samples are compared to each other. In this comparison, most of the dots line up together at the center line supporting that the miRNA expression patterns of the two samples (1 and 2) are highly similar. By contrast, miRNAs with expression levels higher or lower in one sample than the other sample are expected to produce dots that deviate from the center line. The dots are allocated to positions that are above or below than the +2 fold or -2 fold line when the differences are greater than two folds. This was the case when the log₂ values of sample 3 (pNL4-3-transfected HeLa cells) was plotted against sample 1 (B) or 2 (C). The miRNAs with reduced expression in sample 3 are allocated to positions below the -2 fold line. The red-circled miRNAs were chosen for real-time PCR validation as shown in figure 5.

Verification of the specificity and sensitivity of RAKE. A) (a) A prototype small microarray designed to detect a limited number of miRNAs was first used to monitor the specificity of miRNA expression in HeLa and Jurkat cells. For purposes of verifying internal reproducibility of hybridization, each probe on the microarray slide was printed 4 times (spots 1, 2, 3 and 4 labeled at top of each column). The identity of individual probe is labeled next to the slide. Red left-hand filled circle indicates the miRNA expected to be expressed in HeLa cells. Red right-hand filled circle indicates the miRNA expected to be expressed in Jurkat cells. Red fully-filled circle indicates the miRNA expected to be present in both HeLa and Jurkat cells. Unfilled circle indicates the miRNA not expected to appear in either HeLa or Jurkat cells. Orange fully-filled circle represents "spike-in" oligos included act as positive controls to monitor successful hybridization performance. (b) We hybridized small RNAs isolated from HeLa (Left panel) and Jurkat cells (right panel) using microarray slides described in (a). Signals appear as green dots (fluorescence at 532 nm). With the exception of hsa-miR-142-3p in Jurkat cells, cell-specific signals were observed in the microarray hybridizations in patterns consistent with that expected for HeLa and Jurkat cells. 10^-5 M of "spike-in" oligo (ath-miR-157a) was included in the experiment as an indicator of the maximum saturating signal from RAKE (saturated signals appear in white dots). Data are presented here in raw form without further modification or normalization. B) We demonstrated the specificity of RAKE by hybridizing small RNA isolated from Jurkat cells to a subset of polymorphic miRNA (hsa-let-7 family). The names, sequences of the miRNAs and the raw signals detected from the RAKE assay are listed. hsa-let-7c and hsa-let-7f differ from hsa-let-7a in one nucleotide base (highlighted in yellow). However, the signals detected for hsa-let-7a are approximately 16 times less than that detected for hsa-let-7c and hsa-let-7f, suggesting that RAKE can distinguish a single base difference. Similarly, the signals detected for hsa-let-7c are approximately 2.5 times higher than that detected in hsa-let-7b which has only one nucleotide difference (highlighted in yellow). C) To estimate the sensitivity of the RAKE assay, different concentrations of "spike-in" oligo (ath-miR-157a) were hybridized to the small microarray described in (a). The raw data from the four different hybridization reactions (each measuring four replicated spots) are presented on the X-axis at the indicated concentrations of "spike-in" target oligo. Signal intensity of each spot (median pixel) was measured and converted into log₂ scale. A linear range of detection can be observed when the log₂ values are plotted against the concentration of the "spike-in" oligos between 10^-8 to 10^-6 M. An approximate minimum detectable concentration in this RAKE assay is 10^-7 M. Error bars represent the standard deviation of the values from the four replicated spottings of each probe.