Display Settings:

Format

Send to:

Choose Destination
See comment in PubMed Commons below
Cell. 1997 Feb 7;88(3):367-74.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Author information

  • 1Department of Cytogenetics and Molecular Genetics, Women's and Children's Hospital, North Adelaide, Australia. rrichard@medicine.adepaide.edu.au

Abstract

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

PMID:
9039263
[PubMed - indexed for MEDLINE]
Free full text
PubMed Commons home

PubMed Commons

0 comments
How to join PubMed Commons

    Supplemental Content

    Full text links

    Icon for Elsevier Science
    Loading ...
    Write to the Help Desk