Oncogene. 1993 Sep;8(9):2555-9.

Novel DNA binding of p53 mutants and their role in transcriptional activation.

Zhang W, Funk WD, Wright WE, Shay JW, Deisseroth AB.

Source

Department of Hematology, University of Texas M.D. Anderson Cancer Center, Houston 77030.

Abstract

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

PMID:: 8361764; [PubMed - indexed for MEDLINE]

LinkOut - more resources

Other Literature Sources

COS Scholar Universe

Supplemental Content

Save items

Related citations in PubMed

The requirement of the carboxyl terminus of p53 for DNA binding and transcriptional activation depends on the specific p53 binding DNA element. [Oncogene. 1994]
The requirement of the carboxyl terminus of p53 for DNA binding and transcriptional activation depends on the specific p53 binding DNA element.
Zhang W, Guo XY, Deisseroth AB. Oncogene. 1994 Sep; 9(9):2513-21.
Regulation of mutant p53 temperature-sensitive DNA binding. [J Biol Chem. 1996]
Regulation of mutant p53 temperature-sensitive DNA binding.
Friedlander P, Legros Y, Soussi T, Prives C. J Biol Chem. 1996 Oct 11; 271(41):25468-78.
Inactive p53 mutants may enhance the transcriptional activity of wild-type p53. [Cancer Res. 1993]
Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.
Zhang W, Shay JW, Deisseroth A. Cancer Res. 1993 Oct 15; 53(20):4772-5.
Review Discerning the function of p53 by examining its molecular interactions. [Bioessays. 1993]
Review Discerning the function of p53 by examining its molecular interactions.
Oliner JD. Bioessays. 1993 Nov; 15(11):703-7.
Review Transcriptional switches: chemical approaches to gene regulation. [J Biol Chem. 2010]
Review Transcriptional switches: chemical approaches to gene regulation.
Lee LW, Mapp AK. J Biol Chem. 2010 Apr 9; 285(15):11033-8. Epub 2010 Feb 10.

See reviews... See all...

Cited by 17 PubMed Central articles

Expression of a mutant p53 results in an age-related demographic shift in spontaneous lung tumor formation in transgenic mice. [PLoS One. 2009]
Expression of a mutant p53 results in an age-related demographic shift in spontaneous lung tumor formation in transgenic mice.
Duan W, Gao L, Wu X, Hade EM, Gao JX, Ding H, Barsky SH, Otterson GA, Villalona-Calero MA. PLoS One. 2009; 4(5):e5563. Epub 2009 May 15.
Telomerase expression is sufficient for chromosomal integrity in cells lacking p53 dependent G1 checkpoint function. [J Carcinog. 2005]
Telomerase expression is sufficient for chromosomal integrity in cells lacking p53 dependent G1 checkpoint function.
Simpson DA, Livanos E, Heffernan TP, Kaufmann WK. J Carcinog. 2005 Oct 6; 4:18. Epub 2005 Oct 6.
Factors governing loss and rescue of DNA binding upon single and double mutations in the p53 core domain. [Nucleic Acids Res. 2002]
Factors governing loss and rescue of DNA binding upon single and double mutations in the p53 core domain.
Wright JD, Noskov SY, Lim C. Nucleic Acids Res. 2002 Apr 1; 30(7):1563-74.

See all...

Related information

Related Citations
Calculated set of PubMed citations closely related to the selected article(s) retrieved using a word weight algorithm. Related articles are displayed in ranked order from most to least relevant, with the “linked from” citation displayed first.
Gene (OMIM)
Gene records associated with Online Mendelian Inheritance in Man (OMIM) records that cite the current articles in their reference lists.
Nucleotide (Weighted)
Nucleotide records associated with the current articles through the Gene database. These are the related sequences on the Gene record that are added manually by NCBI.
OMIM (calculated)
Online Mendelian Inheritance in Man (OMIM) records that include the current articles as references in the light bulb links within or in the citations at the end of the OMIM record. The references available through the light bulb link are collected using the PubMed related articles algorithm to identify records with similar terminology to the OMIM record.
OMIM (cited)
Online Mendelian Inheritance in Man (OMIM) records that include the current articles as reference cited at the end of the OMIM record.
Protein (Weighted)
Protein records associated with the current articles through related Gene database records. These are the related sequences on the Gene record that are added manually by NCBI.
Substance (MeSH Keyword)
PubChem chemical substance (submitted) records that are classified under the same Medical Subject Headings (MeSH) controlled vocabulary as the current articles.
Cited in PMC
Full-text articles in the PubMed Central Database that cite the current articles.

Recent activity

Clear Turn Off Turn On

Novel DNA binding of p53 mutants and their role in transcriptional activation.
Novel DNA binding of p53 mutants and their role in transcriptional activation.
Oncogene. 1993 Sep ;8(9):2555-9.

PubMed
Third molars as an acute problem in Finnish university students.
Third molars as an acute problem in Finnish university students.
Oral Surg Oral Med Oral Pathol. 1993 Aug ;76(2):135-40.

PubMed
Unravelling the fat embolism syndrome.
Unravelling the fat embolism syndrome.
N Engl J Med. 1993 Sep 23 ;329(13):961-3.

PubMed
Lactococcus lactis: high-level expression of tetanus toxin fragment C and protec...
Lactococcus lactis: high-level expression of tetanus toxin fragment C and protection against lethal challenge.
Mol Microbiol. 1993 Jun ;8(6):1155-62.

PubMed
Hospital vs community (foster) care for psychiatric patients.
Hospital vs community (foster) care for psychiatric patients.
Arch Gen Psychiatry. 1977 Jan ;34(1):78-83.

PubMed

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

PubMed

Result Filters

Display Settings:

Send to:

Novel DNA binding of p53 mutants and their role in transcriptional activation.

Source

Abstract

Publication Types, MeSH Terms, Substances, Grant Support

Publication Types

MeSH Terms

Substances

Grant Support

LinkOut - more resources

Other Literature Sources

Supplemental Content

Save items

Related citations in PubMed

Cited by 17 PubMed Central articles

Related information

Recent activity

Simple NCBI Directory

Getting Started

Resources

Popular

Featured

NCBI Information