Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA

J Biol Chem. 1982 Nov 10;257(21):12924-8.

Abstract

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.

Publication types

  • Research Support, Non-U.S. Gov't

MeSH terms

  • Base Sequence
  • Chloroplasts / analysis*
  • Nucleic Acid Conformation
  • Plants / analysis*
  • RNA, Ribosomal / isolation & purification*
  • Ribonuclease T1

Substances

  • RNA, Ribosomal
  • Ribonuclease T1

Associated data

  • GENBANK/M10757