Format

Send to:

Choose Destination
See comment in PubMed Commons below
Exp Anim. 2013;62(3):267-73.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Author information

  • 1Laboratory of Animal Models for Human Diseases, National Institute of Biomedical Innovation, 7-6-8 Saito-Asagi, Ibaraki, Osaka 567-0085, Japan.

Abstract

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

PMID:
23903062
[PubMed - indexed for MEDLINE]
PMCID:
PMC4160947
Free PMC Article
PubMed Commons home

PubMed Commons

0 comments
How to join PubMed Commons

    Supplemental Content

    Full text links

    Icon for J-STAGE, Japan Science and Technology Information Aggregator, Electronic Icon for PubMed Central
    Loading ...
    Write to the Help Desk