Dot plots depicting normalized MLPA values demonstrate that the genomic regions corresponding to two probe pairs – both localized to exon 17 of SPAST – are present in only a single copy in the three patients. This indicates a heterozygous genomic loss in exon 17 (the final exon) of SPAST. Green dots indicate probe pairs directed against exons of SPAST, blue dots indicate control probe pairs, and red dots indicate probe pairs in regions of copy number change.

a. Local genomic map of the SPAST locus. b. Local view of aCGH results, aligned with the genomic map in [a]. Regions of copy-number loss are indicated by shading and underlined in similar color. In each patient, the deletion spans exon 17, the final exon of SPAST. Arrows indicate the locations of PCR primers used to further define each deletion. As primer pairs span the predicted breakpoints, a deletion is expected to substantially reduce the amplicon size. This enables a PCR product to be amplified from the deleted allele in the three patients, but not from control DNA. c. Results of PCR, followed by agarose gel electrophoresis, which for each patient further confirms a deletion. Cen, centromeric; tel, telomeric.

a. Green bars represent the regions deleted in patients A37, A38, and A39, superimposed on a genomic map of the 3’ end of SPAST. In each case, only exon 17 is deleted. b. A map of repeating elements, obtained from the UCSC genome browser (http://genome.ucsc.edu/) is aligned with [a]. All deletion breakpoints (indicated by dotted lines in [a]) fall within Alu elements; each pair of Alus flanking a deletion are in direct orientation with each other. (c–f). Sequencing of the breakpoint regions in patients A37 and A39 reveals microhomology. c and e. The DNA sequences of the deletion breakpoint regions of mutant patient chromosomes (“A37” and “A39”) are displayed between the telomeric (top) and centromeric (bottom) reference sequences. Perfect sequence identity with one of the reference sequences is indicated with bold blue text. Microhomology (sequence identity among all three sequences) is indicated with bold pink text. A “+” and red lettering indicate a known SNP, as listed by the UCSC genome browser, which matches the sequenced patient DNA. d and f. DNA sequencing traces. The regions of microhomology are boxed. Though the centromeric breakpoints of patients A37 and A39 fall within the same AluY element, their exact locations differ. Del, deletion; cen, centromeric; tel, telomeric.

a. With respect to the reference genome, patient A38 has a heterozygous loss of 16.8 kb and in its place either one or two shorter, inserted sequences. This uncertainty exists owing to several possible inferred series of events that could result in the recombinant, mutant sequence product derived from patient DNA. b. Local genomic map of the SPAST locus, aligned with [b–f]. (c–e). Schematic diagrams of three potential series of FoSTeS events: c. FoSTeS × 2, deleting 16.8 kb (including exon 17) and inserting (creating a non-tandem duplication) between 113 and 136 bp. This mechanistic explanation requires a novel SNP to exist centromeric to breakpoint 2 (see Fig. 5c and text); d. One possible FoSTeS × 3 event, deleting 16.8 kb, inserting/duplicating 113–136 bp, and inserting/duplicating 21–24 bp; and e. Another (of multiple) possible FoSTeS × 3 events, deleting 16.8 kb, inserting/duplicating 113–136 bp, and inserting/duplicating 21–31 bp. f. A map of repeating elements, obtained from the UCSC genome browser (http://genome.ucsc.edu/). All five potential deletion breakpoints (indicated by dotted lines) fall within Alu elements in direct orientation. Del, deletion, cen, centromeric; tel, telomeric.

Sequencing of the breakpoint region reveals that this is a complex rearrangement with multiple instances of microhomology. This suggests one of several multiple-FoSTeS schemes as having generated this rearrangement. The DNA sequence of the breakpoint regions of the mutant patient chromosome (“A38”) is displayed either in between or on top of relevant reference sequences. Perfect sequence identity with one of the reference sequences is indicated by bold colored text, corresponding with the coloring in Fig. 4c–e. Microhomology (homology among three sequences) is indicated by bold pink text. As sequencing was performed in reverse orientation to the reference sequence, sequence traces have been flipped horizontally and a reverse complement (RC) sequence accompanies them. Circled numbers and subscripts signify a correspondence to similarly-labeled FoSTeS events depicted in Fig. 4c–e. As displayed in Fig. 4, all breakpoints localize to directly oriented Alu elements. a. This breakpoint is shared by all possible rearrangement schemes. b. DNA sequencing trace, corresponding to [a], in which the 18 bp region of microhomology is boxed. (c–e). Three of several possibilities for the remaining FoSTeS event(s): c. The second of two breakpoints in this scheme, displaying 7 bp of microhomology and necessitating that the base at Chr2:32,243,095 (in red text with an accompanying asterisk) be a novel SNP on this allele in the patient (see text); d. The second and third breakpoints of one possible FoSTeS × 3 event, featuring four and one bp of microhomology, respectively; e. The second and third breakpoints of another possible FoSTeS × 3 event, featuring seven and five bp of microhomology, respectively. The light blue regions in this figure and Fig. 4 were found by searching for the sequence CAAACTCCTGACCTCGTGATCC, the minimum sequence needed to complete this rearrangement with no requirement for a novel SNP. Though multiple copies of this short sequence exist on chromosome 2, those displayed in [d–e] and in Fig. 4c–d are the copies located most near to the final exon of SPAST (all others are >1 Mb away). f. DNA sequencing trace, corresponding to (c–e) in which the base at Chr2:32,342,095 is marked with a red asterisk.

Removal of the final exon of SPAST may allow in-frame splicing from the penultimate exon (exon 16) of SPAST to exon 2 of SLC30A6 and a fusion protein product to be made.