Nifurtimox and eflornithine resistance mechanisms. (A) Amplified products from the nifurtimox (N) screen. PCR amplification was carried out over 30 cycles using the primers, LIB2f (TAGCCCCTCGAGGGCCAGT) and LIB2r (GGAATTCGATATCAAGCTTGGC); 95 °C for 30 s, 57 °C for 30 s and 72 °C for 130 s. The products were separated in 1% agarose gels and then sequenced directly and also cloned to derive sequence from both ends. This confirmed that each product did indeed represent an RNAi vector-derived target fragment and also allowed precise mapping to the reference genome. M, molecular weight markers; ST, sequences that mapped to repetitive, sub-telomeric domains. (B) Amplified products from the eflornithine (E) screen. Other details as in A. (C) Genetic map (black boxes represent protein-coding sequences) indicating the location of the RNAi target fragments recovered from the library following the nifurtimox and benznidazole screens (grey boxes). (D) Genetic map indicating the location of the RNAi target fragments recovered from the library following the eflornithine screen. The RNAi target fragment used in E is represented by an open box. The locations of predicted AAT6 transmembrane-coding sequences are indicated, as well as a schematic showing the predicted transmembrane (TM) topology (open TM regions are putative). (E) AAT6 knockdown confers resistance to eflornithine. The RNAit program [17] was used to design primers and the pRPa^iSL construct [16] was modified to target AAT6 for RNAi. The resulting hairpin RNAi constructs were transferred to 2T1 cells [16]. For EC₅₀ determination, cells were seeded at 2 × 10³ ml⁻¹ in 96-well plates in an eflornithine 2-fold dilution series. After 66 h growth, 20 μl of Alamar blue (AbD serotec) was added to each well and the plates incubated for a further 6 h. Fluorescence was determined using a Gemini Fluorescent Plate reader (Molecular Devices) at an excitation wavelength of 530 nm, an emission wavelength of 585 nm and a filter cut-off of 570 nm [18]. Error bars indicate sd from triplicate assays. These results were confirmed using three additional independent clones (data not shown).

RNAi library drug resistance screens. (A) The schematic representation illustrates the RNAi library selective screening protocol. (B) Cumulative growth curve during nifurtimox selection. Bloodstream-form T. brucei, MiTat 1.2, clone 221a-derived libraries were maintained as described [16]; >5 × 10⁶ cells per culture at a density of <2 × 10⁶ cells ml⁻¹. Tetracycline (Tet; 1 μg ml⁻¹) was added at −1 day to induce RNAi, and nifurtimox (Bayer, 3 μM; 1 × EC₅₀) was added at time 0. Cultures were maintained thereafter in medium containing Tet and selective drug. Genomic DNA was recovered on day 8 and increased resistance was confirmed to be Tet-dependent (data not shown). The inset shows the drug structure. (C) Cumulative growth curve during eflornithine selection. Eflornithine (Sanofi-Aventis) was applied at 70 μM (2.5 × EC₅₀). Other details as in B.