(A) Control MEF and (B) MEF-SrcY527F cells were permeabilized, fixed and stained for actin (red) and paxillin (green). (C) MEF-SrcY527F cells were transiently transfected with Src siRNA and maintained in culture for 72 h before permeabilization, fixation and staining. (D) MEF-SrcY527F cells were treated with the Src family kinase inhibitor SU6656 (5μM) for 2 h and were then permeabilized, fixed, and stained for actin and paxillin.

Representative MEF-SrcY527F cells from each phenotype were permeabilized, fixed, and stained for actin and general phospho-tyrosine. Spatial ratio images are shown. Red indicates highly localized actin, whereas blue indicates high phospho-tyrosine levels. Intermediate color levels, as shown in the color scale, indicate co-localization.

Cell bodies of MEF-SrcY527F cells were removed, leaving the cytoplasmic faces of the attached ventral membrane exposed. The samples were then fixed, and observed in a scanning electron microscope (SEM). (A) Podosome clusters. (B) An individual podosome. (C) Rosette structure (3–4μm wide). (D) Higher magnification reveals that the rosette is built from podosomes. (E) A structure of larger rings, built in part from two actin belts. Each of the actin belts is about 1–2μm wide, with an ~1–2μm gap between them. (F) Higher magnification reveals the double podosome belt.

Single high–resolution, representative images of all the screen hits, stained for actin. The first four images were taken from controls (untransfected, Risc-Free, and non-targeting controls, and Src siRNA), and are shown for comparison.

(A) RAW 264.7 cells were infected with lentiviral vectors expressing shRNAs targeting Src, or treated with control media. The cells were allowed to differentiate for 72 h, and stained for actin. The image is a montage of 36 single images from the same well. (B) The graph shows the knockdown level of Src mRNA (the fraction of expression, compared to the non-targeted control), analyzed by RT-PCR in RAW 264.7 stable cell lines. The RNA amount was normalized to HPRT. Quantitative PCR was performed with the following primers: Src forward, 5’-GGTGCCTACTGCCTCTCTGTA-3’; Src reverse: 5’-GCGGGAGGTGATGTAGAAACC-3’; HPRT forward: 5′ CTGGTTAAGCAGTACAGCCCCAAA 3′;HPRT reverse 5′ TGGCCTGTATCCAACACTTCGAGA 3′. (C) Phase contrast, time-lapse movies of an Src shRNA-1 stable cell line, and of control cells, were produced 24 h after differentiation began. The figure shows 4 images of the 16-image montage taken at each time point. Four time points are shown, as indicated. At the end of the movie, the cells were stained with phalloidin-FITC (green) and DAPI (blue); the same field is shown for the stained image. (D) Fluorescent time-lapse movies of a differentiated Src shRNA-1 stable cell line, and of control cells, were produced at high magnification (100× /1.3). Four time points are shown; only a fraction of the cells is visible. Several unstable rings are seen in Src shRNA-1 cells; whereas two adjacent sealing zone-like rings are partially seen in control cells.

(A) MEF-SrcY527F cells were permeabilized, fixed and stained for actin and paxillin. Three groups of adhesion structures were defined: Phenotype A, displaying super rings at the periphery of the cell; Phenotype B with rosettes, and Phenotype C, with clusters of peripheral adhesions. Spatial ratio images are shown. Red indicates highly localized actin, whereas blue indicates high paxillin levels. Intermediate color levels, as shown in the color scale, indicate co-localization.
(B) Phenotype distribution in the total population of MEF-SrcY527F cells.

MEF-SrcY527F cells were transiently transfected with GFP-α-actinin (A, B, D), mCherry actin (C) or co-transfected with GFP-cortactin and mCherry actin (E). Time-lapse movies were recorded 24 h later. Frames from the movies, and corresponding times, are shown. An image of the superimposed times is also shown, (A–D) in order to appreciate the dynamics. (E) Stress fibers seem to be anchored to podosomes, but can slide from one podosome to the other, as shown by the pairs of arrowheads.

Schematic description of the screen, including the screening procedure, the number of screened siRNAs, the features extracted, and the number of hits.

The graph shows the percentage of the three major effects (more stress fibers, more rings, and a peripheral belt), of the siRNAs, in each of the three-siRNA libraries.