Domain organization of LrrB and sequence alignment of the conserved domains. A, the domain architecture of LrrB with the SH2 domain, the leucine-rich repeats, the 14-3-3 binding site, and the simple repeat sequences that abound in Dictyostelium genes (thin gray boxes). B, the SH2 domain in LrrB (DDB_G0287823) has an approximately equal level of sequence identity to the v-Src (AAK74060) and human STAT1 (NM_007315) SH2 domains. It is also compared with the SH2 domain of Dictyostelium CldA (DDB_G0278895). The SH2 invariant arginine is indicated by an asterisk. The leucine-rich repeat domain is aligned with similar domains from Leishmania ribonuclease inhibitor-like protein (XP_001566629) and human NOD3 (EAW85351). The 14-3-3 mode 2 consensus binding site was manually identified.

Developmental time course of LrrB expression. RNA samples were prepared from Ax2 cells, developing on filters on water agar and at the time points indicated. Semiquantitative RT-PCR was performed to assess the expression level with 260 ng of RNA for LrrB and 10 ng of RNA for Ig7, which was used as a loading control. Developmental stage marks indicate the approximate midpoint of development stage in Ax2. The lrrB primers were as follows: LrrB05 (5′-CTATGAAGAGAAAGTGCGAGTTATTTGG) (forward) and LrrB08 (5′-TCTCTTAAATCTTGCTCGATTGATG) (reverse); Ig7, 5′-TTACATTTATTAGACCCGAAACCAAGCG (forward) and Ig7rev (5′-TTCCCTTTAGACCTATGGACCTTAGCG) (reverse).

Validation of selected microarray samples. Vegetative RNA samples used for microarray analysis were analyzed for their level of expression of the five indicated genes using QPCR. The bars represent the expression level, expressed as the average -fold change in lrrB⁻ cells relative to Ax2 cells. The error bars indicate S.E. from triplicate samples. Primers used were as follows: for ig7 (DDB_G0294034), TTACATTTATTAGACCCGAAACCAAGCG (forward) and AACAGCTATCACCAAGCTTGATTAGCC (reverse); for cinB (DDB_G0291121), CAAAGGAAGGTATGAAATGGTGTTGG (forward) and CCTTCAGAACTTAAGACATCGGTTTCAGC (reverse); for dsc1A to -C, GGTTTAGTTCAACTCCTCGCAAATGC (forward) and GAATTCACATCTTAATGAAATGTGACCATTCC (reverse); for abcG10 (DDB_G0292986), CTCAACGTATTGCTTTAGGAAATGGTCA (forward) and CACTTGATTTCCTCCATGTTGATGGTC (reverse); for ttdA (DDB_G0269630), GTGCAAATTTAGCTGATAAATCATTTGAAAG (forward) and CTCCAACCGTTGAAAATAGTTCAACTAATC (reverse); for prtB (DDB_G0271666), TTAAATGCTGAAAAAGATGGAGAGTTTCTTG (forward) and GAAAACCAGTTTGAAAATCATTCCCAATATC (reverse).

Developmental time course of the expression pattern for selected genes. Ax2 (■) and lrrB⁻ (○) cells were developed on nitrocellulose filters on agar under uniform light conditions. RNA was prepared from samples harvested at the times indicated and analyzed for cinB, abcG10, ttdA, and dscA to -C expression levels using QPCR. Expression level is expressed as -fold change relative to vegetative Ax2. Developmental stage marks indicate the approximate midpoint of development stage in Ax2. LA, loose aggregate; TM, tight mound; FF, first finger; EC, early culminant.

Mutational analysis of the SH2 domain of LrrB. lrrB⁻ cells (filled black bars) were transformed with either the “empty” TAP-tagging vector (CTAP) (empty bars), a TAP-tagged lrrB gene (LrrB-CTAP) (gray bars), or a TAP-tagged mutant form (LrrB-CTAPmutR, in which arginine 198 of LrrB is substituted by alanine) (cross-hatched bars). RNA was prepared from vegetative transformed cells, and cinB and abcG10 expression levels were measured using QPCR.

Binding of 14-3-3 to LrrB-CTAP. A, Ax2 cells transformed with LrrB-CTAP were harvested and shaken in suspension in KK2 at 1 × 10⁷ cells/ml, and then aliquots were harvested at the time points indicated. LrrB-CTAP in the cell extracts was precipitated using IgG-agarose beads, and the 14-3-3 pulled down was detected by Western analysis using 14-3-3 antibody (lower panel). LrrB-CTAP in cell extracts was also assessed by Western analysis, using TAP antibody, to monitor LrrB-CTAP levels during the time course of the experiment. Similar results, with cells developed on agar, show the same drop in 14-3-3 binding, and low level was maintained up to 18 h. B, Ax2 cells transformed with either LrrB-CTAP or ΔCLrrB-CTAP were harvested during vegetative growth, and LrrB-CTAP or ΔCLrrB-CTAP in the cell extracts was precipitated (as above). Precipitated extracts were analyzed for 14-3-3 (by Western analysis) and quantified using an Odyssey infrared imaging system (LI-COR Biosciences). The amount of 14-3-3 pulled down was quantified then normalized to the LrrB-CTAP (or ΔCLrrB-CTAP) in corresponding cell extracts. Two independent experiments are shown. The top two panels show the LrrB-CTAP/ΔCLrrB-CTAP in cell extracts and 14-3-3 pulled down, and the bar graph represents the normalized values (filled bars, LrrB-CTAP; empty bars, ΔCLrrB-CTAP).

Identification of proteins that bind to LrrB in an SH2 domain-dependent manner. A, structure of LrrB-CTAP and LrrB-CTAPmutR. B, Western blot with an anti-phosphotyrosine antibody of samples from a TAP purification of LrrB-CTAP and LrrB-CTAPmutR after treatment with and without pervanadate. Bands marked a, b, and c are described in the text. C, portion of a colloidal Coomassie staining of a gel bearing a much larger amount of the same samples analyzed in B. The full colloidal Coomassie-stained gel is presented in supplemental Fig. S2. The 130 kDa band (marked as a?) was excised and subjected to tandem mass spectrometry, in parallel with the equivalent gel region taken from the control, non-pervanadate-treated sample. Three proteins were found to be unique to the pervanadate-treated LrrB-CTAP-purified sample. Neither large protein, DDB_G0278895 (CldA, 145 kDa) nor DDB_G0276091 (CldB, 164 kDa), migrate at the sizes expected. This could reflect anomalous migration because of their very large size, or it could indicate the presence of a secondary modification, such as ubiquitination; ubiquitin was the third protein present in band a. D, co-immunoprecipitation (IP) experiments carried out, using the antibodies stated, on extracts from Ax2 co-transformed with LrrB-GFP and CldA-CTAP (right) or with LrrB-GFP and CTAP as a control (left) and analyzed by Western blotting with an anti-GFP antibody. E, co-immunoprecipitation experiments carried out, using the antibodies stated, on extracts from Ax2 co-transformed with LrrB-GFP and CldA-CTAP (right) or with LrrB-GFP and CTAP as a control (left) and analyzed by Western blotting with an anti-TAP antibody. IgG L, IgG light chain carried over from the immunoprecipitation.

The structures of CldA and CldB. A, domain architecture of CldA and CldB. CldA and CldB share a common domain, the Clu domain. This domain was first identified in mitochondrial clustering proteins (21, 22), but it is also present in other proteins, such as ComB, a predicted Rab GTPase of unknown function (29). CldB shows no other hits in a BLAST search, but CldA contains an SH2 domain and several tetracopeptide repeats (TPR). CluA also contains tetracopeptide repeats in a similar relative position as CldA. Simple repeat sequences that abound in Dictyostelium proteins are represented by thin gray boxes. B, alignment of Clu domains from Dictyostelium CldA, CldB, and CluA with Clu domain from Drosophilia Clueless.

Analysis of gene expression in a cldA⁻ strain. Vegetative RNA prepared from the cldA⁻ strain (empty bars) and a random integrant (cldA⁺; black filled bars) and Ax2, was analyzed for expression of the three genes that had been found to be down-regulated in the lrrB⁻, using QPCR. The bars represent expression level, relative to Ax2, and the data for an lrrB⁻ strain (Fig. 3) are presented alongside (gray bars) for comparison. Error bars, S.E. from triplicate experiments.