Expression of FOXD3 by rhesus trophoblasts. A, RT-PCR analysis of rhesus trophoblast stem cells (1192T). RNA was incubated with or without reverse transcriptase (RT), and the cDNA was analyzed using primers against FOXD3 (forward, caccagcagcccctgacatt; reverse, gtgatgagcgcgatgtacga; product size 229 bp). B, Western blot analysis of trophoblast stem cells. Cells were lysed, heated in sample buffer, and subjected to Western blotting using rabbit anti-FOXD3 antibody (Ab64807; AbCam Inc., Cambridge, MA). C, Immunofluorescence analysis of FOXD3 expression in rhesus TSC, primary culture of early gestation trophoblasts (Troph), and paraffin-embedded placental/endometrial tissue (anchoring villus). Cultured cells were fixed and permeabilized using paraformaldehyde and Triton X-100. Tissue from a pregnant (GD35) rhesus implantation site was fixed in formalin and embedded in paraffin. Sections were subjected to antigen retrieval (Antigen retrieval tablets; GeneTex, Inc., San Antonio, TX). Fixed cells and tissue sections were stained using rabbit anti-FOXD3 antibody (AbCam), followed by AlexaFluor488-labeled goat anti-rabbit Ig. Tissue sections were double-stained with a mouse anti-pan-cytokeratin antibody (Biomeda Corp., Foster City, CA), followed by a AlexaFluor647-labeled goat antimouse secondary antibody. Controls were incubated with nonimmune rabbit Ig instead of the anti-FOXD3 antibody. CC, Cytotrophoblast column; CS, cytotrophoblast shell; VT, villous trophoblast. The scale bar represents 50 μm.

Schematic diagram of opportunities for the use of primate embryos to derive TSC and test developmental potential in aggregated embryos and three-dimensional Matrigel explant culture. Rhesus blastocysts give rise in vitro to trophectodermal outgrowths and TSC colonies, which can be aggregated with rhesus embryos for in vitro (in Matrigel three-dimensional culture) and in vivo (with transfer to rhesus monkey transfer recipients) study of putative TSC allocation into differentiated trophoblasts.

Expression of CDX2 by the rhesus monkey blastocyst. Hatched rhesus blastocysts were fixed in paraformaldehyde, permeabilized with Triton X-100, and then incubated with mouse monoclonal anti-CDX2 antibody (CDX2–88, Cell-Marque, Rocklin, CA) followed by AlexaFluor488-conjugated rabbit antimouse secondary antibody (green fluorescence). Controls were incubated with isotype-matched mouse Ig instead of the anti-CDX2 antibody. Nuclei were stained with 4′,6-diamidino-2-phenylindole (blue). The location of the inner cell mass is indicated by an asterisk.

Growth of rhesus monkey blastocysts in Matrigel explant culture. Rhesus monkey blastocysts were produced by in vitro fertilization and the day after hatching were placed into solidified Matrigel droplets. A, Day of placement into the Matrigel. B, Fourteen days after placement into Matrigel. Invasive outgrowths from the surface of the embryo are seen migrating into the Matrigel. C and D, Low-magnification and high-magnification appearance of histological sections of representative embryonic outgrowths from a Matrigel- cultured embryo embedded in paraffin, sectioned, and immunostained with an antibody against cytokeratin 7/8. The Matrigel beyond the outgrowths is undisturbed, whereas the Matrigel through which the outgrowths migrated has been substantially digested. Figure 4 presents a low-magnification image of the digestion of Matrigel at the periphery of an embryo cultured in Matrigel.