Y′HIS3 cDNA is incorporated at telomeres. (A) A schematic of Y′HIS3-Ty1 cDNA. “A_n” represents the oligo(A/T) tract that is derived from the polyadenylated tail of the Y′HIS3 RNA. (B) A drawing depicting Y′HIS3-Ty1 cDNA centromere distal to a subtelomeric X element. To test for the presence of this structure, independent strains harboring Y′HIS3-Ty1 cDNA were obtained by selecting for His⁺ prototrophs from tlc1Δ survivors of strains JC3840 (Maxwell et al. 2004) and JC4153 (MATαade2∷hisG his3Δ1 leu2Δ0 lys2Δ0 tlc1∷LEU2 ura3Δ0 Y′his3AI pRS317TLC1), as previously described (Maxwell et al. 2004). To perform inverse PCR, genomic DNA was digested with NsiI or PvuII and ligated in a total volume of 120 or 150 μl overnight. Aliquots were amplified with primer H3HOPA2 (TCTCCTACTTTCTCCCTTTGCAAACC), a primer that anneals across the HIS3 splice junction, which is indicated by a dotted line, and Xcore2 (ACATGCCATACTCACCTTCAC), a primer that anneals to all core X element sequences adjacent to S. cerevisiae telomeres. Arrows in the diagram indicate the position of these primers. When ligated PvuII fragments were used as templates, a second semi-nested PCR analysis was performed using primer PJ160 (CTTCGTTTATCTTGCCTGCTC), which anneals to the HIS3 promoter, and primer Xcore2 (not illustrated). The major product obtained from each reaction was gel extracted and directly sequenced or cloned and sequenced. The expected structure of inverse PCR products is illustrated. (C) The specific structures of four representative inverse PCR products. Corresponding positions in Ty1 element YPLWTy1-1 or in the indicated chromosome (http://www.yeastgenome.org) are given for the inverse PCR product junction. Drawings are not to scale.

Incorporation of Y′HIS3-Ty1 cDNA is correlated with the appearance of chromosome rearrangements in telomerase-negative survivors. Intact yeast chromosome preparations were separated by clamped homogeneous electric field (CHEF) gel electrophoresis and used for Southern blots as described (Maxwell and Curcio 2007). (A) A representative CHEF gel of intact chromosomes obtained from the telomerase-positive strain (P, lane 1), a His⁻ survivor (S, lane 2), and isolates of the His⁻ survivor, three of which remained His⁻ (lanes 3–5), and six of which were selected for the His⁺ phenotype (lanes 6–11). Asterisks indicate new chromosome bands harboring HIS3 sequences (see below). The yeast chromosome or pair of chromosomes corresponding to each band is listed on the right of the gel image. (B) A Southern blot of the gel in A probed for HIS3 sequences. The his3Δ1 allele on chromosome XV was detected in all lanes. Y′his3AI is present on chromosome V or VIII, and this band was also detected in all lanes. At least one additional band was detected in each sample from His⁺ clones (lanes 6–11). Asterisks indicate the same bands indicated on the gel in A.