(A) S. peucetius microarray analysis of doxorubicin pathway genes, carried out by use of an S. peucetius doxorubicin pathway chip in both the wild-type and the industrial mutant strains. The doxorubicin pathway chips have been described elsewhere (9). The growth phase-dependent transcription profiles of the wild-type (first column) and the mutant (second column) strains and the Cy3-labeled (green) T0 sample were used as references for each time course with the Cy5-labeled (red) samples. The wild-type (green) and industrial mutant (red) samples, both of which were isolated at the same time points, T0 and T1, were then cohybridized with one another (third column). (B and C) S. coelicolor microarray data showing 10 up-regulated (B) and 10 down-regulated (C) genes based on the S. coelicolor whole genome chip in both the wild-type and the industrial mutant strains. The sequenced S. coelicolor genome chips have been described elsewhere (2, 5). The growth phase-dependent transcription profiles of the wild-type strain (first columns) and the mutant strain (second columns) and the T0 sample were used as references for each time course. The wild-type (green) and industrial mutant (red) samples, both of which were isolated at the same time points, T0, T1, and T2, were then cohybridized with one another (third columns). The putative positive (SCO5147) and negative (wblA) regulatory genes are marked by a blue and a red star, respectively. The DNA chips were then scanned with a Genepix Personal 4100A system, and the data were grouped by a hierarchical clustering method (5). ECF, extracytoplasmic function; CoA, coenzyme A. Time points are designated as in Fig. 1C and D.

(A) The S. peucetius wild type (upper-left panel) and the doxorubicin-overproducing industrial mutant (lower-left panel) were grown in an NDYE liquid culture for 6 days and an NDYE plate culture for 8 days (right panel, wild type at left and mutant at right). The recursively mutated industrial S. peucetius strain (generously provided by the Boryung Pharmaceutical Company, Korea) and the wild-type S. peucetius strain (S. peucetius subsp. caesius ATCC 27952, purchased from the American Type Culture Collection) were grown in shake flask cultures in NDYE, maintained in 20% glycerol stock solutions, and stored at −20°C (13). (B) Growth phase-dependent volumetric productivity of doxorubicin by the S. peucetius strains. Standard doxorubicin was purchased from Sigma-Aldrich (St. Louis, MO), and the high-performance liquid chromatography assay has been described elsewhere (13). ND, no detection of doxorubicin. (C) S. peucetius wild-type growth curve and RNA sampling time points. (D) S. peucetius industrial mutant growth curve and RNA sampling time points. OD₆₀₀, optical density at 600 nm.

(A) R2-yeast extract plate cultures of S. coelicolor transformants harboring the empty expression vector pSE34 alone (top, white star) or overexpressing SCO5147 (right, blue star) or wblA (left, red star). (B) NDYE plate cultures of the S. peucetius mutant strains harboring the expression vector pSE34 alone (top, white star), SCO5147 (right, blue star), or wblA (left, red star). (C) Gene expression analysis of the actII-ORF4, redD, redZ, and cdaR genes by RT-PCR. Lane M, 100-bp size marker; lanes 1 and 2, actII-ORF4; lanes 3 and 4, redD; lanes 5 and 6, redZ; lanes 7 and 8, cdaR; lanes 9 and 10, wlbA; lanes 11 and 12, rRNA genes; odd-numbered lanes, RT-PCR with total RNA from S. coelicolor transformants harboring the vector pSE34; even-numbered lanes, RT-PCR with total RNA from S. coelicolor transformants overexpressing wblA. Only the DNA fragment containing a ribosome binding site (RBS) and the open translateral reading frame of wblA without its own promoter was cloned under the ermE* promoter, leading to the increased expression of ermE*-driven wblA in a high-copy-number pSE34 plasmid. Each primer pair (20-mer) was designed to generate a PCR product of approximately 150 to 250 bp. RT-PCR primer sequence pairs (5′ to 3′) were as follows: for rRNA genes, GACTCCTACGGGAGGCAGCA and CGCCCAATAATTCCGGACAA; for actII-ORF4, TCCCTGGTAATTTCGCATCC and CCATGTGCATACGCTGGATT; for redD, CCCTGGAGGATCTCATCAGC and GTACGACTCCAGGGCGTCTC; for redZ, ACGTCGGTCGAAGAACTGGT and GAGGAGGACTTCCGTTTCCC; and for cdaR, CCATCGAAGAGATCGGTCTTG and GCTACGCCCGATGAAGTAGG. (D) Plasmid map of the Streptomyces pSE34-based expression vector (white star) and two putative regulatory genes SCO5147 (blue star) and wblA (red star).