Schematic representation of the substrates used in this study. PAGE-purified oligonucleotides were annealed according to the scheme above to give the nicked, gapped and overhang substrates shown. The sequences (written 5′–3′) of the oligonucleotides used were FAM1: (6-FAM)TAGCATCGATCAGTCCTCp; FAM2: (6-FAM) TAGCATCGATCAGTCCTC; TAMRA: GAGGTCTAGCATCGTTAGTCA(TAMRA); COMP1: TGACTAACGATGCTAGACCTCGAGGACTGATCGATGCTA; COMP2: TGACTAACGATGCTAGACCTCTGAGGACTGATCGATGCTA; COMP3: TGACTAACGATGCTAGACCTCATCCGTTCAGTACGTAGG; COMP4: GTCTAGCTAGTTGTACGAACTGAGGACTGATCGATGCTA.

Mutagenesis of the kinase domain leaves the phosphatase activity of PNK unaffected. The indicated double-labelled oligonucleotide duplexes (50 nM) were incubated with the hPNK K378A mutant at the concentrations shown for 10 min at 37°C. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery.

Inhibition of kinase activity of phosphatase inactive mutants by 3′-phosphorylated DNA. (A) hPNK mutant D171A readily phosphorylates substrates lacking a 3′-phosphate. The indicated oligonucleotide duplexes (50 nM) were incubated with hPNK D171A at the concentrations shown for 10 min at 37°C. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery. (B) 3′-Phosphorylated oligonucleotide duplex inhibits processing of kinase substrate by D171A. Oligonucleotide duplex ‘Overhang’ (50 nM) was incubated with hPNK D171A (4 nM) for 8 min at 37°C in the presence of varying concentrations of 3′-phosphate-containing ‘Competitor’ duplex. After quenching, the samples were resolved in a 20% denaturing PAGE and analysed by fluorimagery. Data points represent the mean, and error bars the standard deviation of three independent experiments. Curve fitting was carried out by non-linear regression using SigmaPlot. The K_i is calculated as the distance between the X-intercepts of the linear plots, which represent lines drawn from V, the highest point of the curve (i.e. in the absence of inhibitor), to cross the curve at V/2, V/3, V/4, V/5 as described by Dixon (20). (C) Nitrocellulose filter-binding assay shows that single and double stranded 3′-phosphorylated substrates are efficiently bound by D171A. Binding reactions contained 100 pM FAM-labelled double-stranded (ds, ‘Overhang’, Figure 1) or single-stranded (ss, FAM1, Figure 1) substrate and concentrations of hPNK D171A ranging from 0.1–81 nM. The extent of binding was measured by nitrocellulose filter binding assay as detailed in the Materials and Methods section. Data points represent the mean, and error bars the standard deviation of three independent experiments. (D) Optimal inhibition is obtained with a recessed 3′-phosphate. Oligonucleotide duplex ‘Overhang’ (50 nM) was incubated with hPNK D171A (4 nM) for 8 min at 37°C in the presence of the indicated competitors (10 nM), where an asterisk corresponds to a 3′-phosphate. After quenching, the samples were resolved in a 20% denaturing PAGE and analysed by fluorimagery. Data points represent the mean, and error bars the standard deviation of three independent experiments.

The kinase activity of PNK is rate-limiting in the repair of a nick flanked by a 3′-phosphate and a 5′-hydroxyl. Double-labelled oligonucleotide duplex (25 nM) was incubated with 25 μg of HeLa S3 whole cell extract at 37°C for the indicated times. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery.

The phosphatase activity of hPNK is faster than its kinase activity in processing a nick and a gap flanked by a 3′-phosphate and a 5′-hydroxyl. The indicated double-labelled oligonucleotide duplexes (50 nM) were incubated with wild-type hPNK at the concentrations shown for 10 min at 37°C. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery.

Mutagenesis of the phosphatase domain also abrogates the kinase function of PNK. The indicated double-labelled oligonucleotide duplexes (50 nM) were incubated with either (A) hPNK D171A or (B) hPNK D173A at the concentrations shown for 10 min at 37°C. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery.

Wild-type PNK has inhibited kinase and phosphatase activity on a nicked substrate containing a 3′-phosphorothioate monoester. (A) Double-labelled nicked duplexes containing a 5′-hydroxyl and either a 3′-phosphate or a 3′-phosphorothioate monoester (50 nM) were incubated with wild-type hPNK (5 nM) for the indicated times. After quenching, the samples were resolved in a 20% denaturing polyacrylamide gel and analysed by fluorimagery. (B) Kinetics of hPNK kinase activity on 3′-phosphorylated or -thiophosphorylated substrates. Data points represent the mean, and error bars the standard deviation of three independent experiments.