Genetic map of the pdxST (yaaDE) region and plasmids carrying different parts of this region. The restriction sites are abbreviated as follows: A, AatII; B, BamHI; E, EcoRI; H, HindIII; N, NcoI; S, SalI; Sh, SphI; Sw, SwaI. The sites shown in parentheses were created by PCR. Deletion mutations are shown with triangles. The 1.4-kb ble cassette is not drawn to scale. His₆ notations indicate that six histidine-encoding codons were added at the 3′ ends of the corresponding genes. To create pBB1181, a 1.8-kb PCR product containing the pdxS and pdxT genes was synthesized using B. subtilis strain SMY chromosomal DNA as a template and pdxST-specific primers oBB120 (5′-GATTTGGATCCGGAATTTGGGGAAGC) and oBB121 (5′-TTATAGTCGACTATAAGTTTCCACAGC), containing BamHI and SalI sites, respectively (indicated in bold). The PCR fragment was cloned in an integrative vector, pBB544 (3). pBB1181 contained a point mutation, shown by an asterisk, in the penultimate codon of the pdxT gene (GGC to AGC with a corresponding Gly-to-Ser change) and was stable only in the pcnB80 zad::Tn10 derivative of E. coli strain JM107 which reduces the plasmid copy number (23) and apparently alleviates the toxicity of the cloned fragment. To create pBB1252, a 1.54-kb DNA fragment coding for the wild-type version of PdxS and a modified version of PdxT containing a His₆ tag at its C terminus was synthesized by PCR, using SMY chromosomal DNA as a template, and oligonucleotides oBB138 (5′-ATAACGGATCCTTGATTAGGGGGACC) and oBB144 (5′-TTTCAGTCGACTTAATGGTGATGGTGATGGTGTACAAGTGCCTTTTGCTTAT) as 5′ and 3′ primers, respectively (the BamHI and SalI sites are indicated in bold, and the histidine codons are underlined). The PCR fragment was first blunt ended, then cut with SalI, and cloned in the expression vector pBAD18 containing the inducible E. coli araBAD promoter (14) and cut with SmaI and SalI. Two derivatives of pBB1252 expressing either PdxT-His₆ only (pBB1256) or unmodified PdxS only (pBB1257) were generated by removing either the 0.37-kb Acc65I (the vector site)-SwaI fragment containing the 5′ part of the pdxS gene or the 0.54-kb fragment between the insert and vector SphI sites containing most of the pdxT gene. Plasmid pBB1261 overexpressing the PdxS-His₆ protein was constructed by cloning the 0.90-kb NcoI-SphI fragment in the pBAD24 vector containing the E. coli araBAD promoter and an appropriate ribosomal binding site (14). The pdxS fragment was synthesized by PCR using SMY chromosomal DNA as a template and oligonucleotides oBB151 (5′-CCAAGCCATGGCTCAAACAGGTAC) and oBB152 (5′-TGTTCGCATGCTTAATGGTGATGGTGATGGTGCCAGCCGCGTTCTTGCAT) as 5′ and 3′ primers, respectively (the NcoI and SphI sites are indicated in bold, and the histidine codons are underlined).

Purification of PdxS, PdxT, and the PdxST complex. The proteins were purified by Ni²⁺ affinity chromatography and subjected to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis. Lane 1, purified PdxS-His₆; lane 2, PdxS-(PdxT-His₆) complex; lane 3, purified PdxT-His₆.

Growth of the yaaE (pdxT) mutant with different ammonium concentrations. Cells of strain BB2256 were grown overnight in TSS-glucose minimal medium with 30 mM NH₄Cl and diluted 100-fold into fresh medium with the indicated NH₄Cl concentrations. OD₆₀₀, optical density at 600 nm.

Glutaminase activity of the PdxT protein and PdxST complex. Purified PdxT-His₆ and PdxS-His₆ were assayed for glutaminase activity singly or in combination after 15 min of preincubation at room temperature. Curve 1, 40 μM PdxT; curve 2, 5 μM PdxT plus 2.5 μM PdxS; curve 3, 5 μM PdxT plus 5 μM PdxS. OD₃₆₃, optical density at 363 nm.