Schematics of the GFP gene targeting system components and rAAVs used. (A) Schematic depiction of artificial gene target (A658). A 35-bp insertion consisting of an in-frame stop codon followed by the recognition site for the Sce endonuclease was inserted at bp 327 of the GFP coding region. The entire insertion sequence is as follows: 5′ TAAGCTCTCGAGATTACCCTGTTATCCCTAAGCTT 3′. (B) Schematic representations of the rAAVs used in this paper. The viruses consist of a single-stranded DNA core with hairpin ends. Repair substrate viruses rAAV.Subs and rAAV.Subs-Puro are missing the first 36 nucleotides of the GFP coding region. Abbreviations: CMV/CBA, cytomegalovirus enhancer/chicken β-actin promoter; EGFP, enhanced GFP; IRES, internal ribosomal entry site; CD8, coding region for the human CD8α coding region; WPRE, woodchuck posttranscriptional regulatory element (36); PGK-Neo, neomycin phosphotransferase gene driven by the phosphoglycerate kinase promoter; TruncGFP, GFP coding region that begins at bp 37 of the coding region; Sce, coding region for the I-SceI endonuclease; Puro, puromycin acetyltransferase gene driven by the SV40 promoter and containing a polyadenylation signal sequence; CMV, cytomegalovirus promoter and enhancer; pA, polyadenylation signal sequence; LacZ, coding region for the β-galactosidase gene.