Interaction of FGFR1 with the AII-responsive region of the FGF-2 gene promoter. Nuclei of control or stimulated (2 h) BAMCs were extracted with 0.3 M KCl containing buffer as described for DNA–protein binding reactions (see MATERIALS AND METHODS). Nuclear proteins were subjected to Western analysis (100 μg/lane) with FGFR1 McAb6 or Southwestern analysis (50 μg/lane) with ³²P (−555/−500 bp) FGF-2 promoter probe. In addition, 400 μg of extracted nuclear proteins from control, forskolin + PMA, or sar¹-AII–treated BAMCs was immunoprecipitated (P) with polyclonal anti-FGFR1 Ab (Santa Cruz Biotechnology) or control polyclonal antibody and was subjected to Southwestern analysis along with the input proteins.

Induction of intracellular FGFR1 is sufficient to transactivate the FGF-2 gene promoter. (A) TE671 cells were transfected with pcDNA3.1FGFR1, pcDNA3.1FGFR1(TK−), pcDNA3.1FGFR1(TM−), pcDNAFGFR1(SP−), or with control pcDNA3.1. Nuclear (N) and cytoplasmic (C) fractions (30 μg of protein per lane) were purified 48 h later and were analyzed with FGFR1 McAb6. (B) TE671 cells were transfected with pcDNA3.1FGFR1, pcDNA3.1FGFR1(TK−), or control pcDNA3.1 (1 μg each). Nuclear (N) and cytoplasmic (C) extracts were prepared 48 h later and analyzed by Western blot with polyclonal FGF-2 Ab. (C) (−650/+314)FGF-2Luc (1 μg) was cotransfected into the TE671 cells with one of the following effector plasmids (1 μg): FGFR1, FGFR1(TM−), FGFR1(SP−), or control pcDNA3.1. The luciferase activity was measured 48 h later. The experiments were repeated two to four times. (D) Expression and transactivation of FGF-2 promoter by FGFR1(SP−/NLS). (Inset) TE671 cells were transfected with pcDNA3.1FGFR1, pcDNA3.1FGFR1(SP−/NLS), or with control pcDNA3.1. Nuclear (N) and cytoplasmic (C) fractions (Western blot with FGFR1 McAb6, 60 μg of protein per lane). Bar graph (−650/+314)FGF-2Luc (1 μg) was cotransfected with (1 μg) pcDNAFGFR1, pcDNAFGFR1(SP−/NLS), or control pcDNA3.1. The luciferase activity was measured 48 h later.

AII or cAMP and PKC activation of the FGF-2 gene promoter is mediated by intracellular FGFR1. (A) Induction of nuclear FGFR1 in BAMC. (Top) Immunofluorescent confocal analysis of endogenous FGFR1 with affinity purified, polyclonal C-term FGFR1 Ab (Hanneken et al., 1995). BAMCs were incubated with sar¹-AII or PMA and forskolin or in control serum-free medium: I, control; II, 0.5 h sar¹-AII; III, 2 h sar¹-AII; IV, 4 h sar¹-AII; V, 4 h forskolin + PMA (all treatments were terminated at the same time). Single optical sections approximately through the middle of the BAMC nuclei are shown. (Bottom) Western blot analysis of FGFR1 with McAb6 in the extranuclear (cytoplasmic, C) fraction an in the total nuclear lysate (N) (30 μg of total nuclear or cytoplasmic proteins per lane). Cells were incubated with forskolin and PMA or in control serum-free medium. (B) BAMCs (4 × 10⁵ cells) were cotransfected with (−650/+314)FGF-2Luc or TH promoter-Luc (Kim et al., 1998) and either pcDNA3.1FGFR1(TK−) or control pcDNA3.1 (1 μg each). Two days later BAMCs transfected with (−650/+314)FGF-2Luc were incubated with 1 μM sar¹AII, or with 5 μM forskolin + 0.1 μM PMA, and cells transfected with TH-Luc were incubated with 5 μM forskolin. No drugs were added to control cultures. Results are combined from two representative experiments, each with triplicate or quadruplicate cultures. (Inset) Dose-dependent inhibition by FGFR1(TK−) of PMA + forskolin stimulation of (−650/+314)FGF-2Luc. (C) BAMCs were cotransfected with 1 μg (−650/+314)FGF-2Luc and with 1 μg of FGFR1, FGFR1(TM−), FGFR1(TK−), or pcDNA3.1, and were treated with forskolin + PMA or control medium for 12 h. (D-F) BAMCs were transfected with (−650/−314)FGF-2Luc. IP6 (400 μM) or suramin (250 μM) was added 1 h before 18-kDa FGF-2 peptide, forskolin and PMA (Fsk + PMA). IP6 was added 1 h before sar¹-AII (AII). Control cultures (Ctr) were not treated with PMA and forskolin or sar¹-AII. Bars represent mean ± SEM of four cultures.

Protein binding to the AII-responsive element. (A) DNase I footprinting of FGF-2 promoter region (coding strand) involved in AII stimulation. Nuclear extracts obtained from control or 0.2 μM sar¹-AII–treated BAMCs were incubated with ³²P-labeled FGF-2 promoter DNA followed by limited digestion with DNase I (“ −” no protein). The products were electrophoresed on 7% sequencing gels. The numbers represent location of bases within the FGF-2 gene promoter determined by using sequencing ladder (not shown). (B) EMSA with [³²P]ATP and T4 kinase labeled −555/−500-bp FGF-2 promoter fragment (1–5 μg protein/lane). Arrows indicate two major DNA-protein complexes and “fp” free probe. (Top left) Nuclear extracts from control or 0.2 μM sar¹-AII (AII)-treated BAMCs (4 h). (Top right) DNA–protein binding reactions were performed in the absence (−) or presence of DNA competitors (25, 50, or 125× molar excess of unlabeled −555/−500-bp target DNA or 125-fold excess of double-stranded target oligonucleotides for STAT1/2, STAT3/4, AP-1, AP-2, or NF-κB). A 25-fold molar excess of unlabeled promoter fragment completely abolished binding). (Bottom) BAMCs were treated with 0.2 μM sar¹-AII in the presence or absence of 10 μM losartan, 1 μM PD-123319, or both. Treatment of control cells with losartan and PD-123319 had no effect on protein binding (not shown). (C) Southwestern analysis, nuclear proteins from control or 0.2 μM sar¹-AII–treated BAMCs were resolved by SDS-PAGE, transferred to nitrocellulose membranes, and probed with a ³²P-labeled (1 × 10⁶ cpm/ml) FGF-2 promoter fragments. The migration of prelabeled molecular weight standards (not shown) is indicated. (D) Binding of tyrosine-phosphorylated proteins to the FGF-2 promoter DNA. (Left) Western analysis with PY-20 anti-phosphotyrosine antibody. Nuclear extracts were prepared from BAMCs treated as indicated (+) with 0.2 μM sar¹-AII, 20 μM genistein, 1 μM PD-123319, or 1 μM losartan for 60 min. Twenty-five micrograms of nuclear proteins was used in all lanes except lanes 2 and 4 (50 μg). (Right) Four hundred micrograms of nuclear proteins from sar¹-AII–treated or control untreated BAMCs was immunoprecipitated (P) with PY-20 antibody and subjected to Southwestern analysis with −555/−500-bp FGF-2 promoter probe along with total nuclear extracts (T, 50 μg of protein). When PY-20 was replaced with control IgG, no binding of precipitated proteins to FGF-2 promoter DNA was detected (Figure 5).

Induction of FGF-2 in BAMCs and identification of the AII-responsive element in FGF-2 gene promoter. (A) Western blot analysis with FGF-2 McAb (lane 1), 5 ng of recombinant 18-kDa FGF-2. Cells were incubated 24 h with sar¹-AII (lanes: 2, 0 nM; 3, 1 nM; 4, 10 nM; 5, 100 nM). One hundred micrograms of total cellular proteins was assayed for FGF-2 as described in Stachowiak et al. (1994). (B) BAMCs were incubated24 h in control medium (II), 100 nM sar¹-AII (III); 10 μM saralasin (IV); and salaralasin and sar¹-AII (V). Cells were immunostained with FGF-2 McAb and horseradish peroxidase-conjugated secondary anti-mouse IgG as in Stachowiak et al. (1994). In I, cells were treated with sar¹-AII and FGF-2 McAb was omitted. (C) Deletion analysis of FGF-2 promoter. (Inset) Time-dependent activation of (−1800/+314)FGF-2Luc in BAMC by sar¹-AII (0.2 μM). Analysis of variance showed an overall statistically significant effect of sar¹-AII (p < 0.0001). Luciferase activity was greater than in the control (0 h) at 6, 24, 30 h (p < 0.05), and at 8 h (p = 0.05) (post hoc test). Constructs, numbers indicate sequences of the FGF-2 gene fused to the luciferase reporter. In (−650/−453)(−103/+314)FGF-2Luc, (−555/−453)(−103/+314)FGF-2Luc, and (−512/−453)(−103/+314)FGF-2Luc, the upstream promoter fragments were ligated directly to the minimal −103/+314 FGF-2 promoter sequence. Forty-eight hours after transfection, BAMCs were incubated for 6 h with 0.2 μM sar¹-AII or in control, serum-free medium. The ratio of luciferase activity to transfected DNA was determined, and the values given are expressed as fold increase over the activity in unstimulated cells. Sar¹-AII had a statistically significant effect on the expression of (−(1800/+314)FGF-2/Luc (p < 0.01), (−650/+314)FGF-2Luc (p < 0.05), (−555/+314)FGF-2Luc (p < 0.0005), (−650/−453)(−103/+314)FGF-2Luc, and (−555/−453)(−103/+314)FGF-2Luc (p < 0.005) (Tukey's post hoc tests). Bars show mean ± SEM. Results are combined from three to four independent experiments. The expression of luciferase activity by promoterless pGL2_Basic was at the background levels and was not affected by sar¹-AII (not shown). Sequence of the −555/−512-bp element essential for sar¹-AII stimulation: CTGCGTCGTCTAATTCAAGTTAGGTCAGTAAAGGAA AC CTTTT. (D) Effects of AT₂ antagonist on activation of (−650/+314)FGF-2Luc by sar¹-AII. BAMCs were incubated with 1 μM PD-123319, 30 min before and during a 6-h treatment with 0.2 μM sar¹-AII. PD-123319 had no significant effect on basal promoter activity in nonstimulated cells (Table 2).