 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 07, 2010 |
| Title |
OD00079_HCP3_N2_MXEMB_2 extraction2_array3 |
| Sample type |
genomic |
| |
|
| Channel 1 |
| Source name |
OD00079_HCP3_N2_MXEMB_2 extraction2_array3 channel_1
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: N2
developmental stage: Mixed Embryo
genotype: wild type
sex: mixed Male and Hermaphrodite population
|
| Growth protocol |
Worm_embryo_growth_and_harvest_vRG1. Synchronized worm cultures were grown at 20 °C in batches of 500 ml using 2.8-L Fernbach flasks shaking at 230 rpm. Gravid adults were separated from debris by sucrose floating. Embryos were isolated by bleaching and fixed after chitinase treatment with 1 % formaldehyde for 10 min on ice. For a detailed protocol see http://www.modencode.org/.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Worm_embryo_extraction_vRG1. Fixed embryos were suspended in 5 volumes of ChIP buffer (50 mM Hepes-KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) and sonicated on ice with a Branson sonifier microtip (30 % power setting for 3 min; 40 % power setting for 1 min). Debris were pelleted at 10 000 g for 20 min and the supernatant was made 10 % in glycerol. The extract was snap frozen in liquid nitrogen aliquots containing 3 mg of protein and stored at ? 80 °C.
Worm_chromatin_immunoprecipitation_vRG1. For each ChIP reaction, 3 mg of protein extract was diluted with ChIP buffer (50 mM Hepes KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) to 900 ?l. Then 35 ?l 30 % sarcosyl (1 % final) and 20 ?l 5 % Na-deoxycholate (0.1 % final) were added. 50 ?l of the diluted extract were removed (input sample), mixed with Elution buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM NaCl, 1 % SDS) and processed as described for ChIP samples. 100 ?l antibody/bead suspension (5?g antibody pre-bound to 50 ?l Dynabeads, suspended in ChIP buffer) was added and the mixture and rotated over night at 4 °C. Beads were washed with 2 × 1 ml FA Buffer (50 mM Hepes-KOH pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 5 min each; with 1 ml FA-1000 buffer (50 mM Hepes-KOH pH 7.6, 1 M NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml FA-500 buffer (50 mM Hepes-KOH pH 7.6, 500 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml TEL buffer (10 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate) for 10 min; and briefly with 1 ml TE buffer (10mM Tris-HCl pH 8.0, 1mM EDTA). Immunocomplexes were eluted with 50 ?l Elution buffer for 15 min at 67 °C. Eluates were incubated over night at 65 °C to reverse cross-links, then treated with proteinase K (0.44 mg/ml) at 37 °C for 2 h. Nucleic acids were recovered by phenol/chloroform extraction and ethanol precipitation. After digestion with RNAse A (0.33 mg/ml) for 2h at 37 °C, DNA was purified using the Qiagen PCR purification kit.
Worm_LM-PCR_Amplification_for_ChIP-chip_vRG1. ChIP and input DNA was blunt ended with T4 polymerase for 20 min at 12 °C and purified by phenol/chloroform extraction and EtOH precipitation. Annealed oligonucleotide linkers (oligo 1: gcggtgacccgggagatctgaattc; oligo 2: gaattcagatc) were ligated to the DNA fragments over night at 16 °C. The ligated DNA was precipitated with EtOH, disolved in 10 mM Tris-HCl pH 8, and amplified with a Taq/Pfu polymerase mix using oligo 1. For a detailed protocol see http://www.modencode.org/.
|
| Label |
Cy5 dye
|
| Label protocol |
ChIP-chip_label_hyb_nimblegen_v2. DNA was labeled and hybridized to NimbleGen C. elegans tiling array (HD2) according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008 with slight modifications. Briefly, amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| |
|
| Channel 2 |
| Source name |
OD00079_HCP3_N2_MXEMB_2 extraction2_array3 channel_2
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: N2
developmental stage: Mixed Embryo
genotype: wild type
sex: mixed Male and Hermaphrodite population
|
| Growth protocol |
Worm_embryo_growth_and_harvest_vRG1. Synchronized worm cultures were grown at 20 °C in batches of 500 ml using 2.8-L Fernbach flasks shaking at 230 rpm. Gravid adults were separated from debris by sucrose floating. Embryos were isolated by bleaching and fixed after chitinase treatment with 1 % formaldehyde for 10 min on ice. For a detailed protocol see http://www.modencode.org/.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Worm_embryo_extraction_vRG1. Fixed embryos were suspended in 5 volumes of ChIP buffer (50 mM Hepes-KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) and sonicated on ice with a Branson sonifier microtip (30 % power setting for 3 min; 40 % power setting for 1 min). Debris were pelleted at 10 000 g for 20 min and the supernatant was made 10 % in glycerol. The extract was snap frozen in liquid nitrogen aliquots containing 3 mg of protein and stored at ? 80 °C.
Worm_chromatin_immunoprecipitation_vRG1. For each ChIP reaction, 3 mg of protein extract was diluted with ChIP buffer (50 mM Hepes KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) to 900 ?l. Then 35 ?l 30 % sarcosyl (1 % final) and 20 ?l 5 % Na-deoxycholate (0.1 % final) were added. 50 ?l of the diluted extract were removed (input sample), mixed with Elution buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM NaCl, 1 % SDS) and processed as described for ChIP samples. 100 ?l antibody/bead suspension (5?g antibody pre-bound to 50 ?l Dynabeads, suspended in ChIP buffer) was added and the mixture and rotated over night at 4 °C. Beads were washed with 2 × 1 ml FA Buffer (50 mM Hepes-KOH pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 5 min each; with 1 ml FA-1000 buffer (50 mM Hepes-KOH pH 7.6, 1 M NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml FA-500 buffer (50 mM Hepes-KOH pH 7.6, 500 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml TEL buffer (10 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate) for 10 min; and briefly with 1 ml TE buffer (10mM Tris-HCl pH 8.0, 1mM EDTA). Immunocomplexes were eluted with 50 ?l Elution buffer for 15 min at 67 °C. Eluates were incubated over night at 65 °C to reverse cross-links, then treated with proteinase K (0.44 mg/ml) at 37 °C for 2 h. Nucleic acids were recovered by phenol/chloroform extraction and ethanol precipitation. After digestion with RNAse A (0.33 mg/ml) for 2h at 37 °C, DNA was purified using the Qiagen PCR purification kit.
Worm_LM-PCR_Amplification_for_ChIP-chip_vRG1. ChIP and input DNA was blunt ended with T4 polymerase for 20 min at 12 °C and purified by phenol/chloroform extraction and EtOH precipitation. Annealed oligonucleotide linkers (oligo 1: gcggtgacccgggagatctgaattc; oligo 2: gaattcagatc) were ligated to the DNA fragments over night at 16 °C. The ligated DNA was precipitated with EtOH, disolved in 10 mM Tris-HCl pH 8, and amplified with a Taq/Pfu polymerase mix using oligo 1. For a detailed protocol see http://www.modencode.org/.
|
| Label |
Cy3 dye
|
| Label protocol |
ChIP-chip_label_hyb_nimblegen_v2. DNA was labeled and hybridized to NimbleGen C. elegans tiling array (HD2) according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008 with slight modifications. Briefly, amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| |
|
| |
| Hybridization protocol |
ChIP-chip_label_hyb_nimblegen_v2. DNA was labeled and hybridized to NimbleGen C. elegans tiling array (HD2) according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008 with slight modifications. Briefly, amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| Scan protocol |
ChIP-chip_scanning_nimblegen_v2. Array scanning and raw data extraction were performed according to the protocol described in chapter 5 and 6 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, array signal was scanned by using a GenePix 4000B Scanner with associated software and saved as .tif files of the 532nm and 635nm images individually. Raw signal intensities of the images were extracted and saved as .pair files by using NimbleScan software v2.5 according to the NimbleScan User?s Guide.
|
| Description |
channel ch1 is ChIP DNA; Antibody information listed below: official name: OD00079 HCP3;target name: HCP-3;host: Rabbit;antigen: N-terminal histone tail of HCP-3;clonal: Polyclonal;purified: Affinity;company: Other;catalog: Desai Lab;reference: Monen et al. (2005) Nat Cell Biol 7: 1248-55;short description: A GST fusion of the HCP-3 N-terminal histone tail was injected into rabbit and the serum affinity-purified against a 6His fusion of the antigen;
channel ch2 is input DNA;
|
| Data processing |
ChIP-chip normalization standard nimblegen:JL:1 protocol. ChIP-chip_normalization_standard_nimblegen_v1. The log2-ratio ratio of intensity from sample/reference channel was scaled to center the ratio data around zero by subtracting the bi-weight mean for the log2-ratio values for all features on the array from each log2-ratio value. This was performed using NimbleScan software according to the NimbleScan v2.4 User?s Guide and chapter 6 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis (version 3.1, 27 May 2008) at Roche NimbleGen. Processed data are obtained using following parameters: genome version is WS180
ChIP-chip normalization standard nimblegen:JL:1 protocol. ChIP-chip_normalization_standard_nimblegen_v1. The log2-ratio ratio of intensity from sample/reference channel was scaled to center the ratio data around zero by subtracting the bi-weight mean for the log2-ratio values for all features on the array from each log2-ratio value. This was performed using NimbleScan software according to the NimbleScan v2.4 User?s Guide and chapter 6 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis (version 3.1, 27 May 2008) at Roche NimbleGen. Processed data are obtained using following parameters: genome version is WS180
|
| |
|
| Submission date |
Jul 05, 2010 |
| Last update date |
Jul 06, 2010 |
| Contact name |
DCC modENCODE |
| E-mail(s) |
help@modencode.org
|
| Phone |
416-673-8579
|
| Organization name |
Ontario Institute for Cancer Research
|
| Lab |
modENCODE DCC
|
| Street address |
MaRS Centre, South Tower, 101 College Street, Suite 800
|
| City |
Toronto |
| State/province |
Ontario |
| ZIP/Postal code |
M5G 0A3 |
| Country |
Canada |
| |
|
| Platform ID |
GPL7483 |
| Series (1) |
|
| Supplementary file |
Size |
Download |
File type/resource |
| GSM562761_OD00079_HCP3_N2_MXEMB_2_1462302_532.pair.gz |
6.6 Mb |
(ftp)(http) |
PAIR |
| GSM562761_OD00079_HCP3_N2_MXEMB_2_1462302_635.pair.gz |
6.5 Mb |
(ftp)(http) |
PAIR |
| Processed data are available on Series record |
|
|
|
|
 |
