NCBI > GEO > Accession Display Not logged in | Login
GEO help: Mouse over screen elements for information.
Scope:    Format:    Amount:   GEO accession:    Go
Platform GPL7092 Query DataSets for GPL7092
Status Public on Jul 25, 2008
Title Galbraith Laboratory Operon Long Oligonucleotide Microarray version 3.0 (ATq306.01.Z)
Technology type spotted oligonucleotide
Distribution non-commercial
Organism(s) Arabidopsis thaliana
Manufacturer The Galbraith Laboratory, University of Arizona
Manufacture protocol This oligonucleotide array is produced from the Operon Version 3.0 Array-Ready Oligo set (AROS), which comprises 29,110 70-mer oligonucleotides representing 26,173 protein-coding genes, and 28,964 protein-encoding gene transcripts, and 87 microRNA gene precursors. AROS design is based on ATH1 release 5.0 of the TIGR Arabidopsis genome annotation database, and Release 4.0 of the miRNA Registry at the Sanger Institute. Various additional elements are printed as controls. Microarrays can be ordered from the Galbraith laboratory. This platform represents slides ATq306.01.001-ATq306.01.400 (http://www.ag.arizona.edu/microarray).
Support glass
Coating aminosilane
 
 
Web link http://ag.arizona.edu/microarray
Contributor(s) Galbraith DW
Submission date Jul 23, 2008
Contact name David William Galbraith
E-mail(s) galbraith@arizona.edu
Phone 520-621-9153
URL http://latin.arizona.edu/galbraith
Organization name University of Arizona
Department Plant Sciences and Bio5 Institute
Lab Galbraith
Street address 303 Forbes Building
City Tucson
State/province AZ
ZIP/Postal code 85721
Country USA
 

Data table header descriptions
ID
OligoID Assigned by OPERON, or by STRATAGENE or the Galbraith Lab (control elements)
ORF Chromosomal-based gene locus names
Description Description of the gene locus
SEQUENCE Sequence of spotted oligonucleotides
SPOT_ID

Data table
ID OligoID ORF Description SEQUENCE SPOT_ID
1_01_01 A201036_01 At1g75780 tubulin beta-1 chain (TUB1) nearly identical to SP|P12411 Tubulin beta-1 chain {Arabidopsis thaliana} CCAAGATGCTACCGCTGATGAAGAAGACGAATATGATGAAGAAGAAGAACAAGTTTACGAATCTTGATCT
1_01_02 atc06 Randomly generated negative control CAGGAATGCCCCGTCTATAGGGGAACCTGCCTATTGGTGCGTAATTAATCGGCCCTGGGCATCCACCTCG --Randomly generated negative control
1_01_03 A001934_01 At1g17745 D-3-phosphoglycerate dehydrogenase / 3-PGDH identical to SP|O04130 AAAGGAGTACAGTCCATTAGGGTGGTCTATCGGTCAGCTCGTGACCGAGATGATTTGGATACTAGACTAC
1_01_04 A020780_01 At2g17190 ubiquitin family protein contains INTERPRO:IPR000626 ubiquitin domain GAATAGGAACACGGCTGGCCAGGATCCTACGCAAACTGGTGCTGCGACAGGGACAGCCAATAACGGAGGA
1_01_05 Alien2 Control: Stratagene Spotreport Alien Oligo --Control: Stratagene Spotreport Alien Oligo
1_01_06 Alien8 Control: Stratagene Spotreport Alien Oligo --Control: Stratagene Spotreport Alien Oligo
1_01_07 atc04 Randomly generated negative control CTGCACGGAAACCGCGGGTTTTGGACGGAGCACGCACGTAGCTCGCGATATACTTACGCCGTTGCCTCCC --Randomly generated negative control
1_01_08 atc10 Randomly generated negative control CTGATCAGTACGCGCCGCGTTGCTCGTGACTAGATACGTTACCGCGCGCCGAATCTTAAAGTTCAAACTC --Randomly generated negative control
1_01_09 A000489_01 At1g03550 secretory carrier membrane protein (SCAMP) family protein contains Pfam domain, PF04144: SCAMP family ACTACTAATGCTGCAGTCGGGATAATGTATTTCATTGGTGCTGGGTTCTTCTGCATCGAAACACTTCTCA
1_01_10 A024634_01 At1g03630 protochlorophyllide reductase C, chloroplast / PCR C / NADPH-protochlorophyllide oxidoreductase C (PORC) identical to SP:O48741 protochlorophyllide reductase C, chloroplast precursor (EC 1.3.1.33) (PCR C) (NADPH-protochlorophyllide oxidoreductase C) (POR CTTTGGCTGGGAATGTACCGCCAAAGGCAAACCTTGGAGACCTAAGAGGCTTAGCGTCAGGATTGAATGG
1_01_11 At30000321 At1g03780 targeting protein-related similar to microtubule-associated protein / targeting protein for Xklp2 ((TPX2) GI:8926138) {Homo sapiens}; similar to Restricted expression proliferation associated protein 100 (p100) (Differentially expressed in lung cells 2) ( AACCTAAGCAATGCACACAACCAGAACCGTTCCAGTTAGAGAGTCTAGTAAGGCACGAAGAGGAAATGCG
1_01_12 A000429_01 At1g03840 zinc finger (C2H2 type) family protein contains Zinc finger,C2H2 type,domain contains Pfam domain, PF00096: Zinc finger, C2H2 type CAGCCGCATTCACCGCAAGAGGATTACAATTGGGTTTTCGGAAACGCGAATAATCACGGCGAGTTAATAA
1_01_13 At30000345 At1g03960 calcium-binding EF hand family protein contains Pfam profile: PF00036 EF hand AGGAGCCAAAGCGCCAACTCATTCCTCAGTTCTACTACCAACACGGGCGTCCACCAGCAAAAGAACTAAA
1_01_14 A001796_01 At1g04020 zinc finger (C3HC4-type RING finger) family protein / BRCT domain-containing protein contains Pfam domain, PF00533: BRCA1 C Terminus (BRCT) domain AAAGAGCTTGTTCTCTGTGGATCAGCACTCTCTAAAAGTGATAAGAAACTGATGGAAAGTTTAGCCGTTC
1_01_15 A023201_01 At1g04180 flavin-containing monooxygenase family protein / FMO family protein similar to flavin-containing monooxygenases YUCCA [gi:16555352], YUCCA2 [gi:16555354], and YUCCA3 [gi:16555356] from Arabidopsis thaliana; contains Pfam profile PF00743 AGTCTGCTCGGTTTGATGAAACTAGCGGGCTATGGAGGGTTAGAACAACCTCAGACGGAGAGGAGATGGA
1_01_16 A024273_01 At1g04240 auxin-responsive protein / indoleacetic acid-induced protein 3 (IAA3) identical to SP|Q38822 Auxin-responsive protein IAA3 (Indoleacetic acid-induced protein 3) {Arabidopsis thaliana}; EST gb|T04296 comes from this gene GGGTTTCTCGGGCAAGATCTATGTTCATTGGATTGAATCCAATTCATAGCCTTTATTTACCTCATCGGTA
1_01_17 A001919_01 At1g06900 peptidase M16 family protein / insulinase family protein contains Pfam domain, PF05193: Peptidase M16 inactive domain; similar to insulin-degrading enzyme (Insulysin, Insulinase, Insulin protease) [Mouse] SWISS-PROT:Q9JHR7 AATCAGTTGAGGACAAAGGAGCAGCTTGGTTATGTTGTCGAGTGTGGCCCTCGCTTAACGTATCGTGTGC
1_01_18 A003588_01 At1g06960 small nuclear ribonucleoprotein U2B, putative / spliceosomal protein, putative non-consensus splice donor GC at exon 4; similar to spliceosomal protein (U2B) GI:169588 from [Solanum tuberosum] AACCCGGAATTGCGTTTGTGGAGTATGAAGACGATGTTCAGTCTTCCATGGCCATGCAGGCTCTTCAGGG
1_01_19 A001564_01 At1g07120 expressed protein AAAAGATTCTCTGACGCAGGCCTTGCAAAGGATTCAATCGTTGCAAGACAGGTTAGAGGAAAGTGTTAAC
1_01_20 A200275_01 At1g07170 expressed protein contains Pfam domain PF03660: Uncharacterised protein family (UPF0123) GTTCGGATCGGCGGCTCGGAGATCAGGGATCGCTAGTTCAGACACCTTCTCTTCTTCTTCGTTCTCCTTC

Total number of rows: 32448

Table truncated, full table size 6448 Kbytes.




Download family Format
SOFT formatted family file(s) SOFT
MINiML formatted family file(s) MINiML

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Section 508 |
NCBI Home NCBI Search NCBI SiteMap