Skip to main content
NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
View SNP Submission Batch
Submitter Handle:EGP_SNPS
Submitter Batch ID:DIA1-PDR90-071503
Submitter Method ID:METHOD-E
Citation:NIEHS-SNPs, Environmental Genome Project, NIEHS ES15478.
Population:PDR90
Comment:THESE SNPS WERE GENERATED AS PART OF THE NIEHS SUPPORTED GRANT (HL66682) FOR THE ENVIRONMENTAL GENOME PROJECT TO DEVELOP SNP RESOURCES DISTRIBUTED TO THE RESEARCH COMMUNITY. PLEASE SEE EGP.GS.WASHINGTON.EDU FOR DETAILS ON HOW TO CITE THIS WORK. THE FIRST DESCRIPTOR IN THE "SUBMITTER SNP ID:" FIELD INDICATES THE HUGO ASSIGNED NAME OF THE GENE STUDIED. THE SECOND NUMBER DENOTES THE VARIANT BASE POSITION IN THE LISTED GENBANK ACCESSION NUMBER.
Batch Total SubSNP(ss) Count:181


all, sort by
SubSNP(ss) Submitter
SNP_ID
SNP
Allele
Samplesize RefSNP(rs) ss2rs
Orien
Chr ChrPos Contig
Accession
Contig
Pos
ss12583982 DIA1-003165 A/T 174 rs8190387 0 22 42646676 NT_011520.13 23937112
ss12583981 DIA1-003129 A/G 176 rs8190386 0 22 42646712 NT_011520.13 23937148
ss12583980 DIA1-002760 C/T 144 rs2284090 1 22 42647081 NT_011520.13 23937517
ss12583979 DIA1-002677 A/C 142 rs5996204 1 22 42647164 NT_011520.13 23937600
ss12583978 DIA1-002672 C/G 142 rs2267458 1 22 42647169 NT_011520.13 23937605
ss12583977 DIA1-002609 A/C 142 rs8190385 0 22 42647232 NT_011520.13 23937668
ss12583976 DIA1-002332 G/T 160 rs8190384 0 22 42647509 NT_011520.13 23937945
ss12583975 DIA1-002239 -/CTATTTTTTGTACTTTTAGTAGAGACAGG 138 rs376525577 0 22 42647573 NT_011520.13 23938009
ss12583974 DIA1-002199 C/T 152 rs8190382 0 22 42647613 NT_011520.13 23938049
ss12583973 DIA1-002060 C/T 150 rs8190381 0 22 42647752 NT_011520.13 23938188
ss12583972 DIA1-001987 A/G 148 rs8190380 0 22 42647825 NT_011520.13 23938261
ss12583970 DIA1-001864 A/T 152 rs2267459 1 22 42647948 NT_011520.13 23938384
ss12583969 DIA1-001678 C/T 162 rs8190378 0 22 42648134 NT_011520.13 23938570
ss12583968 DIA1-001669 A/G 160 rs8190377 0 22 42648143 NT_011520.13 23938579
ss12583967 DIA1-001610 A/T 160 rs137142 1 22 42648202 NT_011520.13 23938638
ss12583965 DIA1-001529 -/CCTCTA 170 rs8190375 0 22 42648278 NT_011520.13 23938714
ss12583964 DIA1-001246 C/T 172 rs8190373 0 22 42648564 NT_011520.13 23939000
ss12583963 DIA1-001244 -/GTCC 172 rs199960666 1 22 42648564 NT_011520.13 23939000
ss12583962 DIA1-001088 G/T 170 rs8190372 0 22 42648720 NT_011520.13 23939156
ss12583961 DIA1-001049 C/T 172 rs8190371 0 22 42648759 NT_011520.13 23939195
ss12583960 DIA1-000519 C/T 178 rs8190370 0 22 42649289 NT_011520.13 23939725
ss12583959 DIA1-000427 A/G 178 rs8190369 0 22 42649381 NT_011520.13 23939817
ss12583958 DIA1-000356 A/C 178 rs8190368 0 22 42649452 NT_011520.13 23939888
ss12583957 DIA1-000301 -/A 166 rs8190367 0 22 42649507 NT_011520.13 23939943
ss12583956 DIA1-000276 A/G 162 rs8190366 0 22 42649531 NT_011520.13 23939967
ss12583955 DIA1-000248 A/G 160 rs8190365 0 22 42649559 NT_011520.13 23939995
ss12583954 DIA1-000220 A/G 142 rs8190364 0 22 42649587 NT_011520.13 23940023
ss12583953 DIA1-000192 -/C 98 rs8190363 0 22 42649615 NT_011520.13 23940051
ss12583966 DIA1-001585 -/GGACCTGGAGTCTCCTCCTTGGGGA 160 N.D. N.D.
ss12583971 DIA1-001942 -/CTTTTTT 150 N.D. N.D.
30 of 181 subsnp's starting at ss12583982. ss# starting at ss

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement