Skip to main content
NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs267234880                 
RefSNP
Organism:honey bee (Apis mellifera)
Molecule Type:Genomic
Created/Updated in build:137/140
Map to Genome Build:102/Weight
Validation Status:
Allele
Variation Class:NAMED:
insertion/deletion variation or named repetitive element
RefSNP Alleles:(UNK1602B) (FWD)
Allele Origin:
Ancestral Allele:Not available
Links
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' to see variant in the new NCBI variation viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A


  Submitter records for this RefSNP Cluster back to top
The submission ss181956786 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs267234880 during BLAST analysis for the current build.


NCBI
Assay ID
Handle|Submitter IDValidation
Status
ss to rs
Orientation
/Strand
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
Date
Update
Date
Build
Added
Molecule
Type
Freq
Warning
Ancestral
Allele
Success
Rate
ss181956786UNISTS|UNK1602Bfwd/(UNK1602B)atcatcatgtgcttcagtagctaaatcatgacaggtccctcaacgtctgcaatacaaaca12/15/0912/15/09137Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs267234880|allelePos=526|totalLen=1045|taxid=7460|snpclass=5|alleles='(UNK1602B)'|mol=Genomic|build=137
 AAAGTGCTCT TATCTGTTCC ATGTATACCA AATATTCTCC TGTAGCTTCT TTCCCTTGCA
 TTTCACAATA AACTACACCT GCATCTTCGC CTTCACCACT AACATGATGT ATTTCAGTAA
 GAAAAGCTGC ATCCTACAAA AATAAATTTT TTTTTTATTT TATTACTTTA TAAATATTTT
 ACATATATCT GTAAAATATA TATGTAATGT AATGTAATTT TACATATATA ATGTAAAATA
 TTAAAAATTT ATTATATATA TTATATATTA TACCGTAAGT AATGGATAAA GTATATGATC
 TAAATATATA GGCATTAAAG ATAGAAATCC TTCACTTCCA GCAGTTATCA TAGTATAAAA
 AGTAGAATCA ATTTGTGTTG CAGCATTAGT ACCAGATGCT AAACATCTAT TGGCCAATAA
 GTCCAAAACA CCTTTATATG GATAATCCTC ACTACCCAGG AAAACAAGAT GTTCCAATGT
 ATGAGGTAGT CCATCATCAT
 CATGTGCTTC AGTAGCTAAA TCATG
 N
 ACAGGTCCCT CAACGTCTGC
 AATACAAACA GTAATTCCAG TATCTCTGGA TTTATAAATA TGTACCGGTA TTGTATCATT
 TGCTTTTATT GAATATATAA AGTCAAATGC TCCCATGTTT TCTCTTGGTG AATTGTCTAC
 CGGCGCCATG TTATATCTCA TTAAATTTCT GCTAACTTTA AAACTTTTTA AAAGCGATAC
 CAATATTTAA ATTTTTATAT CTGAAGAAAT GCAACTTACG TATAAAACAA TCGACAAATT
 ATTGAAATTA TCAAGAGAGC ATCAGAAGTC AAAGATGTAC ATATATTTCG AATAATACTT
 TAATTAAACT TCACTCTAGG ATGTTTAAAA TTTTGAATTC TTTTTATAAT TTTTGACTAG
 TAGAATCAAA AAATATCAAT CTTAACTATC GGAATTCATT AATTTAAAAA TTGTATGTAT
 GTTGCGTTTT TAAGCTATTT TATGGGTTAC AAGATGCCAT GTTGATCTTT TGCACAATCC
 TATTGGATAA TAAAAGTAT

  NCBI Resource Links back to top
Submitter-Referenced
dbSNP Blast Analysis
3D structure mapping
XP_395182  

  Population Diversity (in rs orientation) back to top
There is no frequency data.

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data
UNKNOWNUNKNOWNUNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement