Skip to main content
NCBI
dbSNP

PubMed Nucleotide Protein Genome Structure PopSet Taxonomy OMIM Books SNP
Search for SNP on NCBI Reference Assembly
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs267234873                 
RefSNP
Organism:honey bee (Apis mellifera)
Molecule Type:Genomic
Created/Updated in build:137/140
Map to Genome Build:102/Weight
Validation Status:
Allele
Variation Class:NAMED:
insertion/deletion variation or named repetitive element
RefSNP Alleles:(K1652) (REV)
Allele Origin:
Ancestral Allele:Not available
Links
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' or 'Contig Pos' column value to see variation in NCBI sequence viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A


  Submitter records for this RefSNP Cluster back to top
The submission ss181956758 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs267234873 during BLAST analysis for the current build.


NCBI
Assay ID
Handle|Submitter IDValidation
Status
ss to rs
Orientation
/Strand
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
Date
Update
Date
Build
Added
Molecule
Type
Freq
Warning
Ancestral
Allele
Success
Rate
ss181956758UNISTS|K1652fwd/(K1652)aatagagcattcacctgtttcatcaagcaggatatcgaagcacgtgcgcttcttaaagga12/15/0912/15/09137Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs267234873|allelePos=524|totalLen=1042|taxid=7460|snpclass=5|alleles='(K1652)'|mol=Genomic|build=137
 CGTAAGTGCG GTTGCCATTT TTTTTTTTTT TTGAAAAAGC TTCGCGAAAT TTTTTCCATT
 AATTGAAGTC TGATTTTTCT GAATATTCTT ATTTCTCTCT CTTTCTCTCT CTCTGATTTT
 TCAAATGTGT AATTAATTAA CAAATGTAAC TTTTTTTGAT TGATTCGATA CTTTTCTAAT
 TTAATGGAAG CTTTGAATTG TATAATTGCA TAGGTGAAAA TTATTTTTAT AGAACGTATA
 ATATAATTAC AAAAGGTGAA ATTTAGAAAT CGATCATTGA ATTAGTTGAA AAGAAAGAGT
 ATCGTTTGAT CTAATTCCAA TATGTTTCCG CTTGGTGAGC GGTTATTTTC TCGCAACGTT
 TGTATAGAAT GGTGTATCCA CGTGTTAAAT AAACCATCTT GTTAATCTAT TCGCCTGTGA
 AGGCGCAATG CGTCTTTCAC GCGTGCCTTT TGCGAAAGTA TAAACTGTAC CGGTTATTAC
 AGCGTATACG CTTAATAGAG
 CATTCACCTG TTTCATCAAG CAG
 N
 GATATCGAAG CACGTGCGC
 TTCTTAAAGG AATAGACGTT TAGAAATTAT TTCATTATTA GAGTAATTAT GATATATTAT
 TTTTAGGGAA AATTTTTAGA GAAATTCTTT TTCTCTCTCT CTTTCTCTTT GAAACGTGTA
 ATTTTTGATC ATGCATTACT GTATTTTGAG CGATCAAAAT ACAAGTGCAA ATTTTAATTA
 CGAAGAATAA TTTATTTTTG TAAGAAGAAT ATTAGGGGAA AATTCTAGGG GATCTTTTAT
 CGACCGTAGG TATATAGGAA TTTTTCTACG AAAATACCAT AGTATCGAAG ATATTGTTAA
 CTTCGGTTTA GTAAGATTTA AAGTGACGTA TTAAATCCCC AGATAGGAGC GAAAAAGAAG
 GAAATATTGA GAGGAAAGAG ATAACGCGAA TCAGTTCTCT TCGGAGACGG AATAAAATTT
 ATTCGTACGC GTGGAAAAGC AAATCTCACG AACTTTCTCG TGGCAAATCT CCACGATTTG
 AATCTCGTTT AAACCGCGA

  NCBI Resource Links back to top
Submitter-Referenced
dbSNP Blast Analysis

  Population Diversity (in rs orientation) Note: rs267234873 allele is reverse to the genome back to top
There is no frequency data.

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data
UNKNOWNUNKNOWNUNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement