NCBI
dbSNP

PubMed Nucleotide Protein Genome Structure PopSet Taxonomy OMIM Books SNP
Search for SNP on NCBI Reference Assembly
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Reference SNP (refSNP) Cluster Report: rs267234870                 
RefSNP
Organism:honey bee (Apis mellifera)
Molecule Type:Genomic
Created/Updated in build:137/140
Map to Genome Build:102/Weight
Validation Status:
Allele
Variation Class:NAMED:
insertion/deletion variation or named repetitive element
RefSNP Alleles:(K1653) (REV)
Allele Origin:
Ancestral Allele:Not available
Links
SNP Details are organized in the following sections:
GeneView Map Submission Fasta Resource Diversity Validation

  Integrated Maps (Hint: click on 'Chr Pos' to see variant in the new NCBI variation viewer) back to top

  GeneView back to top

GeneView via direct blast against RefSeq sequences (used when no gene model is available): N/A


  Submitter records for this RefSNP Cluster back to top
The submission ss181956746 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs267234870 during BLAST analysis for the current build.


NCBI
Assay ID
Handle|Submitter IDValidation
Status
ss to rs
Orientation
/Strand
Alleles5' Near Seq 30 bp3' Near Seq 30 bpEntry
Date
Update
Date
Build
Added
Molecule
Type
Freq
Warning
Ancestral
Allele
Success
Rate
ss181956746UNISTS|K1653fwd/(K1653)gaaattccaaagggatgggataagagcggtttgccaaacctggaagccgtcttcgtcttc12/15/0912/15/09137Genomicunknown

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|rs267234870|allelePos=520|totalLen=847|taxid=7460|snpclass=5|alleles='(K1653)'|mol=Genomic|build=137
 GCGGTTTCGG CGTCGACCGC GATGAACAGG CGTCTGTCAA CAGAAATCAT TTCTTAAAAT
 TACTTTACGC TCTTCGATTT AATTTTAAAA AATAATCATC TTTTTTATAA TCGTGGCCAA
 CTTATTTATA TCTATTATTT CTTTTTAAAT CTCCTTGTAT ACATATGTGT AAAAAACTGT
 GAAAGAAAAA ATTAAAAAAA ATCTTTTTTC CTTCGTCATA TATATATACA TAAAAGTTTC
 GAAAGAATCG AAAAATAAAA TTGCTTGCAC TTCCACTTCG GTCAAATATT TGGACGTTGG
 CCCCCAAAGT GAAATTCACC GGTGGAAGAA AACTCGTGGA ATTGTGAAAG GATCCATTGT
 CCCGCTATCA CTATGGCGGA TCGATAAAAG CTCGGGGCTC GATTAAGTTG TGTAACGACC
 AAAGGCCAAG CATCGTTTAT CCCATTACCA AGGTACAAGG GAGAGGTGAA TTGTCGAATG
 GACGCTTTAG AAATTCCAAA
 GGGATGGGAT AAGAGCGGT
 N
 TTGCCAAACC TGGAAGCC
 GTCTTCGTCT TCGTCTTTTC TGACGTTTTT GACTCCAATG CTATTAATTC GTGATCAAAA
 GAGGCAACGG TTCTTTCTCT CTTTTTTAAC ATGACACGTT TGGCCGTTTT TTTTCACCCT
 CGGTTGACTC GGGTTAACGC GATAACATTA ATCGGATGAA GGAGAATTAG ATCTTGGGTC
 GAGGAGTTGA TCGGACCGTT GAATAATAAC AAGGAAAATT AGATAAGTTG TGGGGATATG
 GGTCAATTCT TGGCCCAGTC TTCTTCACTC GTTCTACATC GTAATCAGGG TGTAAGTAAT
 CGAACACGA

  NCBI Resource Links back to top
Submitter-Referenced
dbSNP Blast Analysis

  Population Diversity (in rs orientation) Note: rs267234870 allele is reverse to the genome back to top
There is no frequency data.

  Validation Summary: back to top
Validation statusMarker displays
Mendelian segregation
PCR results confirmed
in multiple reactions
Homozygotes detected
in individual genotype data
UNKNOWNUNKNOWNUNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement