Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012848694

Eukaryota (3 taxa) STS probe DXS963E for VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) (VMA21) and 2 more genes

Synopsis

Field NameValues
NameDXS963E
AliasessWXD775
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pongo abelii; Homo sapiens
Target genesVMA21 (Pongo abelii); VMA21 (Nomascus leucogenys); VMA21 (Homo sapiens)

Sequences

>Probe|12848694|PRIMERF Forward PCR primer (outermost) (21b)
AGTGAGATTACACTGAACGTG
>Probe|12848694|PRIMERR Reverse PCR primer (outermost) (24b)
CACATAATCTATGAATAGCTTAAT

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS963E
Homo sapiensphysicalWUSTL-XX4.5 ordinalsWXD775

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID99008
Probe Cross-refcontext specific help for: Probe Cross-refGDB:452923
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk